Chemical weedicide induced promoter and application thereof
A promoter and molecular technology, applied in the fields of application, biochemical equipment and methods, botany equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0034] Embodiment 1: the preparation of probe
[0035] Design a pair of primers according to the nucleotide sequence of maize In2-1 cDNA:
[0036] 5' end primer XIG 52: 5'CCAGGCTGTACATCTGCTA 3' (SEQ ID No.1)
[0037] 3' primer XIG 31: 5'AACTGTCTCTTCTCAGCATC 3' (SEQ ID No.2)
[0038] Then PCR was carried out using the recombinant λZAP Express DNA of the rice root cDNA library as a template. The reaction conditions were denaturation at 94°C for 4 minutes, followed by 30 cycles of 94°C for 40s, 48°C for 60s, and 72°C for 90s, and finally 72°C for 10 minutes. The PCR products were detected and recovered by electrophoresis.
[0039] The above PCR product was connected with GEM-T Easy Vector, and transformed into Escherichia coli DH5α to obtain the recombinant. Plasmids were purified with High Pure Plasmid Purification Kit, and the clones that did contain the correct insert were sequenced. See SEQ ID No.3 for the detailed sequence. Example 2: Isolation and identification of XIG...
Embodiment 2
[0039] The above PCR product was connected with GEM-T Easy Vector, and transformed into Escherichia coli DH5α to obtain the recombinant. Plasmids were purified with High Pure Plasmid Purification Kit, and the clones that did contain the correct insert were sequenced. See SEQ ID No.3 for the detailed sequence. Example 2: Isolation and identification of XIG cDNA
[0040] Inoculate Escherichia coli XL1-Blue MRF' in LB liquid medium containing 50 μg / ml tetracycline and cultivate overnight. The next day, the bacterial solution was inoculated into 50ml liquid LB without antibiotics at a ratio of 1:100, and cultured to the OD of the bacterial solution 600 =0.5. Centrifuge at 1000g, remove the supernatant, add 8ml of 10mmol / L magnesium sulfate solution to resuspend the cells. Get the λZAP Express phage (at least 2.7 × 10 5 phages (equivalent to containing a rice genome) were mixed and incubated at 37°C for 15 minutes to fully adsorb the phages. Take an appropriate amount of the m...
Embodiment 3
[0048] The pBK-CMV plasmid was extracted by alkaline method, and T3 / T7 primers were used for PCR to identify the size of the inserted fragment. Using various restriction enzymes, a physical map of the insert is constructed. Insert the digested fragment into the pBlueScript II SK+ plasmid to construct a subclone. Sequencing was performed using the T3 / T7 primer sequences located on both sides of the multiple cloning site of the pBlueScript II SK+ plasmid, and the nucleotide sequences of each subclone were spliced according to the physical map to obtain the full sequence of the cDNA (see SEQ ID No.4). The deduced amino acid sequence is 242 amino acids (see SEQ ID No. 5). Example 3: Northern blot analysis of induced expression of XIG
[0049] Take an appropriate amount of rice seeds, soak them in tap water for a while, and remove immature seeds. Then sterilized with 3% hydrogen peroxide solution for 30 minutes, washed several times with sterile water, and soaked in sterile wa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More