Chemical weedicide induced promoter and application thereof

A promoter and molecular technology, applied in the fields of application, biochemical equipment and methods, botany equipment and methods, etc.

Inactive Publication Date: 2002-12-18
FUDAN UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

No work has been reported on the application of herbicide-induced promoters to transgenic plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: the preparation of probe

[0035] Design a pair of primers according to the nucleotide sequence of maize In2-1 cDNA:

[0036] 5' end primer XIG 52: 5'CCAGGCTGTACATCTGCTA 3' (SEQ ID No.1)

[0037] 3' primer XIG 31: 5'AACTGTCTCTTCTCAGCATC 3' (SEQ ID No.2)

[0038] Then PCR was carried out using the recombinant λZAP Express DNA of the rice root cDNA library as a template. The reaction conditions were denaturation at 94°C for 4 minutes, followed by 30 cycles of 94°C for 40s, 48°C for 60s, and 72°C for 90s, and finally 72°C for 10 minutes. The PCR products were detected and recovered by electrophoresis.

[0039] The above PCR product was connected with GEM-T Easy Vector, and transformed into Escherichia coli DH5α to obtain the recombinant. Plasmids were purified with High Pure Plasmid Purification Kit, and the clones that did contain the correct insert were sequenced. See SEQ ID No.3 for the detailed sequence. Example 2: Isolation and identification of XIG...

Embodiment 2

[0039] The above PCR product was connected with GEM-T Easy Vector, and transformed into Escherichia coli DH5α to obtain the recombinant. Plasmids were purified with High Pure Plasmid Purification Kit, and the clones that did contain the correct insert were sequenced. See SEQ ID No.3 for the detailed sequence. Example 2: Isolation and identification of XIG cDNA

[0040] Inoculate Escherichia coli XL1-Blue MRF' in LB liquid medium containing 50 μg / ml tetracycline and cultivate overnight. The next day, the bacterial solution was inoculated into 50ml liquid LB without antibiotics at a ratio of 1:100, and cultured to the OD of the bacterial solution 600 =0.5. Centrifuge at 1000g, remove the supernatant, add 8ml of 10mmol / L magnesium sulfate solution to resuspend the cells. Get the λZAP Express phage (at least 2.7 × 10 5 phages (equivalent to containing a rice genome) were mixed and incubated at 37°C for 15 minutes to fully adsorb the phages. Take an appropriate amount of the m...

Embodiment 3

[0048] The pBK-CMV plasmid was extracted by alkaline method, and T3 / T7 primers were used for PCR to identify the size of the inserted fragment. Using various restriction enzymes, a physical map of the insert is constructed. Insert the digested fragment into the pBlueScript II SK+ plasmid to construct a subclone. Sequencing was performed using the T3 / T7 primer sequences located on both sides of the multiple cloning site of the pBlueScript II SK+ plasmid, and the nucleotide sequences of each subclone were spliced ​​according to the physical map to obtain the full sequence of the cDNA (see SEQ ID No.4). The deduced amino acid sequence is 242 amino acids (see SEQ ID No. 5). Example 3: Northern blot analysis of induced expression of XIG

[0049] Take an appropriate amount of rice seeds, soak them in tap water for a while, and remove immature seeds. Then sterilized with 3% hydrogen peroxide solution for 30 minutes, washed several times with sterile water, and soaked in sterile wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of genje engineering technology. It particular, it relates to a promoter segment capable of separating and utilizing nucleic acid. Said promoter is originated from some genes which are sensitive to sulfonylurea compounds (such as chlor-sulfuron and ethametsulfuron) and related compounds in the plants of rice, etc. The nucleic acid sequence of the coded desired target product gene and one above-mentioned promotor segment are fused to obtain recombinant DNA, then this recombinant DNA is used to transform plant, and a new transgenic plant can be obtained. The expression of target gene being in said recombinant DNA in the new plant is controlled by proper chemical inducer.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a promoter fragment for isolating and utilizing nucleic acid. The promoter is derived from p-sulfonylurea compounds (such as chlorsulfuron, ethamuron) and related Some genes to which the compound is sensitive. The nucleic acid sequence encoding the desired target product gene and one of the above-mentioned promoter fragments are fused to obtain a recombinant DNA, and the plant is transformed with the recombinant DNA to obtain a new transgenic plant. In new plants the expression of the gene of interest in the recombinant DNA is regulated by suitable chemical inducers. Background technique [0002] Transgenic technology has become a powerful tool to solve the problems encountered by multicellular organisms, and it is also true in the field of plants, which includes introducing endogenous or exogenous genes into plants to modify certain functions or change ge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01H1/00A01H5/10C12N15/29C12N15/82
Inventor王喜萍蒯本科曹凯鸣张翼飞史晰胡伟明
OwnerFUDAN UNIV