Unlock instant, AI-driven research and patent intelligence for your innovation.

Secondary lymphoid chemotactic factor SLC preparation method

A chemokine and lymphoid technology, applied in a new preparation field, can solve the problems of high cost, complicated cell culture, difficult purification and the like, and achieve the effects of low cost, low cost and convenient operation.

Inactive Publication Date: 2003-06-11
武圣明 +2
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Preparation method It has been reported abroad that insect cells are used to express SLC (NagiraM et al. The Journal Of Biological Chemistry 1997.272, 19518-19524). They injected recombinant SLC into mouse lung tumor entities, and 40% of the tumors disappeared, showing the potential of SLC. The effect of treating tumors, but the cost of expressing with insect cells is high, and cell culture is cumbersome; domestic units have expressed SLC with Escherichia coli (Wang Dongning et al. Bioengineering Journal 2001 17(4) 392-395)
However, the product expressed in E. coli is not easy to purify

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Secondary lymphoid chemotactic factor SLC preparation method
  • Secondary lymphoid chemotactic factor SLC preparation method

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0018] Specific embodiments: carrier used in the present invention P PIC9 and P PIC9K was purchased from Invitrogen, and the Escherichia coli host strain TOP10 and the Pichia host strain GS115 used were also purchased from Invitrogen. The specific operation steps are as follows:

[0019] 1. Construction of SLC recombinant expression plasmid P PIC9K / SLC (see figure 1 )

[0020] 1. Synthetic primers:

[0021] In order to isolate the secondary lymphoid chemokine SLC gene fragment from the human lung cDNA library, according to the expression vector P A pair of primers were designed for the cloning site of PIC9K and the structure of the SLC gene, and the 5' ends of the forward primer and the reverse primer were respectively introduced into XhoI and ECoRI restriction sites ( CTCGAG with GAATTC ), the forward primer is: 5′GG CTCGAG AAAAGAAGTGGAGGGGCTCAG3', the reverse primer is: 5'CC GAATTC CTATGGCCCTTTAGGGGTC3'.

[0022] 2. PCR amplification:

[0023] The human lung c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention is a new producing method for human inferior lymph appulsive factor SLC. The expressing system in this invention is biche yeast expressing system, it includes following steps: (1) synthesizes positive and reverse guide, and PCR expanses them with mould of human lung cDNA, constructs SLC reconstruction expressing particle pPIC9K / SLC; (2) pPIC9K / SLC is linearized and is electric breakdown into biche yeast receiver cell GS115, and gets the engineering fungus GS115 / pPIC9K / SLC; (3) the engineering fungus inductively cultivates and expresses SLC, after purifying, there gets the human inferior lymph appulsive factor SLC.

Description

Technical field: [0001] The invention relates to the technical field of medical bioengineering, and is a new preparation method of human secondary lymphoid chemokine SLC. Background technique: [0002] Chemokines are a family of structurally related and functionally distinct small molecule cytokines (8-12KDa). They are expressed in various tissue cells and leukocytes. Chemokines play an important role in both physiological and pathological conditions of the body. Chemokines and receptors are involved in inflammation, tumors, autoimmune diseases, angiogenesis, allergy, differentiation of stem cells, development of secondary lymphoid organs, and viral infections such as AIDS. Nearly 50 chemokines have been discovered so far. There are 4 conserved cysteines in the primary structure of most chemokines. According to the number and relative position of cysteines, chemokines are divided into four major subfamilies according to systematic nomenclature: CXC chemokine C chemokines...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/16A61P35/00C12N15/81C12P21/02
Inventor 武圣明高卜渝袁汉英
Owner 武圣明