Secondary lymphoid chemotactic factor SLC preparation method
A chemokine and lymphoid technology, applied in a new preparation field, can solve the problems of high cost, complicated cell culture, difficult purification and the like, and achieve the effects of low cost, low cost and convenient operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach
[0018] Specific embodiments: carrier used in the present invention P PIC9 and P PIC9K was purchased from Invitrogen, and the Escherichia coli host strain TOP10 and the Pichia host strain GS115 used were also purchased from Invitrogen. The specific operation steps are as follows:
[0019] 1. Construction of SLC recombinant expression plasmid P PIC9K / SLC (see figure 1 )
[0020] 1. Synthetic primers:
[0021] In order to isolate the secondary lymphoid chemokine SLC gene fragment from the human lung cDNA library, according to the expression vector P A pair of primers were designed for the cloning site of PIC9K and the structure of the SLC gene, and the 5' ends of the forward primer and the reverse primer were respectively introduced into XhoI and ECoRI restriction sites ( CTCGAG with GAATTC ), the forward primer is: 5′GG CTCGAG AAAAGAAGTGGAGGGGCTCAG3', the reverse primer is: 5'CC GAATTC CTATGGCCCTTTAGGGGTC3'.
[0022] 2. PCR amplification:
[0023] The human lung c...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 