Genetic polymorphisms in the preprotachykinin gene

A polymorphism, gene technology, applied in the direction of tachykinin, genetic engineering, plant genetic improvement, etc., can solve problems such as difficult identification

Inactive Publication Date: 2005-06-08
F HOFFMANN LA ROCHE & CO AG
View PDF12 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Polymorphisms associated with pathological syndromes are highly variable and thus may be difficult to identify

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic polymorphisms in the preprotachykinin gene
  • Genetic polymorphisms in the preprotachykinin gene
  • Genetic polymorphisms in the preprotachykinin gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0178] Embodiment 1: polymorphism detection

[0179] All SNPs were discovered by double-stranded DNA sequencing using ABI capillary sequencer and Big Dye chemistry (ABI). First, the genomic structure of the NKNA gene was obtained from a PAC clone with accession number EM-HUM1: AC004140.1 in the EMBL database, which was found by BLAST search with NKNA mRNA (accession number U37529.1 in the EMBL database). Exon-intron boundaries were obtained, as indicated in Figure 1, and primers were designed to amplify all coding and regulatory regions of the gene. Primers used to amplify all exons are shown below and were also used as sequencing primers. All polymorphisms were targeted using these primer pairs:

[0180] Primer type

Nucleotide sequence

SEO ID NO

Primer 1

CATGTTTACAATACATATTGGCAC

SEQ ID NO.2

Primer 2

GTATATGATGAATGATG

SEQ ID NO.3

Primer 3

CACCCTCATTCTTCCCTGC

SEQ ID NO.4

Primer 4

CTTCAGTCTCACCA...

Embodiment 2

[0184] Example 2: Genotype Detection

[0185] a) Selection of experimental subjects

[0186] The study protocol and informed consent form were submitted to the local ethics committee for approval. All subjects made a written commitment to have their blood samples used for genotyping. This promise is rescindable after no more than one month if the subject changes their mind.

[0187]All samples are assigned new independent codes, and the link between the new codes and the original codes will be deleted within six months after the closure of the clinical database. This was an additional measure to ensure subject confidentiality; however, it turned out that it was not possible to find genotype information by subject's name or original clinical trial number. After about 15 years, all blood and DNA samples will be destroyed.

[0188] b) Genotype detection experiment

[0189] Single blood samples (9 ml) were collected in EDTA tubes. The blood samples were frozen and stored bet...

Embodiment 3

[0203] Example 3: Vomiting Test

[0204] The emesis test described was performed in two studies, one single dose augmentation study (SAD) and the other multiple dose augmentation study (MAD). In SAD, the emesis test was tested after ingestion of 2-(3,5-bis-trifluoromethyl-phenyl)-N-methyl-N-(6-morpholin-4-yl-4-O-tolyl -pyridin-3-yl)-isobutyramide 6 and / or 24 hours later. In MAD, emesis tests were performed 6 or 24 hours after the last dose following once-a-day dosing for 14 days.

[0205] SAD

[0206] 5, 10, 20, 40, 80, 160, 230 and 400 mg of 2-(3,5-di-trifluoromethyl-phenyl)-N-methyl-N- (6-Morpholin-4-yl-4-O-tolyl-pyridin-3-yl)-isobutyramide was administered orally to subjects in a drinking emulsion. Six or 24 hours after oral administration of the drug, subjects were subcutaneously injected with 50 μg / kg of apomorphine in the lower abdomen. The time of apomorphine injection was recorded. Subjects were asked to sit upright immediately after injection. They remained in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a method of correlating single nucleotide polymorphisms in the pre-tachykininogen (NKNA) gene with the efficacy and compatibility of pharmaceutically active compounds administered to human subjects. The present invention also relates to a method of determining the efficacy and compatibility of a pharmaceutically active compound administered to a human individual, the method comprising detecting at least one single nucleotide polymorphism in the NKNA gene. The method is based on the detection of specific single nucleotide polymorphisms in the NKNA gene and the determination of the efficacy and compatibility of pharmaceutically active compounds in human subjects with reference to the NKNA gene polymorphisms. The present invention also relates to isolated nucleic acids comprising polymorphisms as defined herein in their sequence, to nucleic acid primers and oligonucleotide probes capable of hybridizing to such nucleic acids, to nucleic acids comprising one or more of such primers and probes A diagnostic kit for detecting NKNA gene polymorphisms, relating to a pharmaceutical pack containing an NK-1 receptor antagonist and instructions for administering the drug to a human individual subject to polymorphism detection, and also to a stored NKNA gene polymorphism A computer readable medium of state sequence information.

Description

field of invention [0001] The present invention relates to a method of correlating single nucleotide polymorphisms in the preprotachykinin (NKNA) gene with the efficacy and compatibility of pharmaceutically active compounds administered to human subjects. [0002] The present invention also relates to a method for determining the efficacy and compatibility of a pharmaceutically active compound administered to a human individual, the method comprising detecting at least one single nucleotide polymorphism in the NKNA gene. Said method is based on detection of specific single nucleotide polymorphisms in NKNA gene and reference to polymorphisms in NKNA to determine the efficacy and compatibility of pharmaceutically active compounds in human subjects. The invention also relates to an isolated nucleic acid comprising a polymorphism as defined herein in its sequence, to nucleic acid primers and oligonucleotide probes capable of hybridizing to such nucleic acid and to nucleic acids co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K31/00A61K31/436A61K31/5377A61K31/541A61K38/00G01N33/50A61K45/00A61P1/04A61P1/08A61P9/00A61P11/02A61P11/06A61P13/08A61P17/02A61P19/02A61P25/00A61P25/02A61P25/06A61P25/18A61P25/22A61P25/24A61P25/28A61P25/36A61P27/02A61P29/00A61P35/00A61P37/08A61Q5/10C07D213/75C07K7/22C12N15/09C12N15/11C12N15/12C12Q1/68G01N33/15
CPCC12Q1/6883C12Q2600/156A61P1/04A61P1/08A61P11/00A61P11/02A61P11/06A61P13/08A61P17/02A61P19/00A61P19/02A61P25/00A61P25/02A61P25/06A61P25/18A61P25/22A61P25/24A61P25/28A61P25/36A61P27/00A61P27/02A61P29/00A61P35/00A61P37/08A61P9/00A61K31/00C12Q1/6827
InventorD·费恩兹勒L·哈希莫托J·李E·吕丁A·斯雷特P·万肯
OwnerF HOFFMANN LA ROCHE & CO AG