Interfusion protein of human interleukin 15 and Fe

A technology of interleukin and fusion protein, applied in the field of genetically engineered human interleukin-15 and Fc fusion protein, which can solve the problems of short half-life, limited biological activity, and small molecular weight of natural IL-15

Active Publication Date: 2006-04-19
上海海欣生物技术有限公司
View PDF0 Cites 47 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, due to the small molecular weight of natural IL-15 and its short half-life after in vivo application, its biological activity in vivo is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interfusion protein of human interleukin 15 and Fe
  • Interfusion protein of human interleukin 15 and Fe
  • Interfusion protein of human interleukin 15 and Fe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Cloning of human IL-15 functional gene and Fc fragment gene of human IgG4

[0049] 1. Cloning of IL-15 functional gene:

[0050] Adherent mononuclear cells were isolated from the peripheral blood of normal people, and after being stimulated by adding LPS for 4 hours, the total RNA was extracted by one-step method of guanidine isothiocyanate, the first strand of cDNA was synthesized by AMV reverse transcriptase, and PCR was carried out separately using it as a template To amplify the wild-type human mature IL-15 cDNA sequence, the primers used are:

[0051] Upstream primer: P15'AACTGGGTGAATGTAATAAG 3'

[0052] Downstream primer: P25'AGAAGTGTTGATGAACA TTTG3'

[0053] The estimated size of the PCR product of human IL-15 is 790bp, the PCR reaction volume is 50μl, the primer concentration is 0.4μM, and the amplification parameters are 94°C for 30 seconds, 51°C for 45 seconds, and 72°C for 50 seconds. After 30 cycles, the product line 2% agarose gel electrophore...

Embodiment 2

[0058] Example 2: Construction of Yeast Secretion Vector Encoding IL15-Fc Fusion Protein

[0059] Using pMD18T-IL15 and pMD18T-Fc as templates, primers were designed to amplify the IL15 and Fc fragments, and then IL15 was connected to the modified α signal peptide on the pPICK vector, while the Fc fragment was connected to the downstream region of IL15 to form a gene encoding IL15 - The carrier of the Fc fusion protein, named pPIC9K-IL15-Fc.

[0060] (a) Amplification of IL-15 fragments

[0061] For the IL15 fragment, the primer sequences used for amplification are:

[0062] Upstream primer IL15-F: -CGAGAAAAGAAACTGGGTTAACGTTATCTC-

[0063] Downstream primer IL15-RE: -CGGAATTCGGAAGTGTTGATGAACAT-

[0064] Using pMD18T-IL15 as a template, the IL15 fragment was amplified by conventional PCR method. The amplification conditions were 97°C, 2min; 94°C, 30s, 58°C, 30s, 72°C, 45s, a total of 25 cycles; then 72°C, 10min; and finally stored at 4°C. As a result, a 360bp target fragme...

Embodiment 3

[0086] Example 3: Establishment and Identification of Yeast Engineering Strains Expressing IL15-Fc Fusion Protein

[0087] Take 5-10 μg of the recombinant plasmid pPIC9K-IL15-Fc and the control plasmid pPIC9K large pumping plasmid, each take 5-10 μg after Sac I digestion and linearization, transform the yeast strain GS115 by electric shock method, and use MD (glucose minimal medium) plate screening after transformation His + clone. Mix all the transformed clones with water, and spread 105 yeasts on the G418 gradient resistance YPD plate (G418 concentrations are 0, 0.25, 0.5, 0.75, 1.0, 1.5, 1.75, 2.0, 3.0 and 4.0mg / ml). Incubate at 30°C for 2-5 days. Pick several recombinant colonies on each gradient resistance plate and inoculate them in 20ml of BMGY medium medium, culture them in shake flasks at 30°C, grow to the bacterial cell concentration A600nm=2~6, collect the bacteria by centrifugation, and replace them with 5-10 times The volume (100ml) of BMMY (containing 0.5% me...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Expressionaaaaaaaaaa
Login to View More

Abstract

A human interleukin 15-Fc fusion protein composed of interleukin 15 and the Fc fragment of human immunoglobulin, which are linked via joining peptide, the nucleic acid ofr coding it, the expression carrier containing said nucleic acid, its composite medicine for preventing and treating microbial infection and its preparing process are disclosed.

Description

technical field [0001] The present invention relates to the technical field of utilizing recombinant DNA, more specifically, the present invention relates to genetically engineered human interleukin-15 (Interleukin-15, IL-15) and Fc fusion protein, its application and preparation method. Background of the invention [0002] Interleukin 15 (IL 15) is a newly discovered cytokine of interleukins, which has similar biological activities to interleukin 2 (IL-2), can promote the differentiation and proliferation of B cells, and induce the proliferation of NK cells , cytotoxic activity, and cytokine production. It cooperates with IL 12 to promote NK cells to produce IFN-γ, which plays an important role in regulating the function of NK cells and the body's immunity. [0003] First, IL-15, as part of the early immune response to anti-microbial infection in the body, can continue to function in an environment that is not conducive to the expression of pro-inflammatory cytokines (such ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/63A61K39/395A61K38/20A61P31/00
Inventor王建莉
Owner上海海欣生物技术有限公司