Plant RNAi binary expression vector with forward and reverse promoters

A dual expression vector and dual promoter technology, applied in the biological field, can solve the problems of heavy workload, tediousness, and high cost, and achieve the effect of saving time and financial resources

Inactive Publication Date: 2006-10-11
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The construction of this structure involves the connection of 3 or 2 segments. Similarly, for the study of a single gene, it is not a difficult problem to construct such a structure. If many genes are silenced in this way, if they are reverse-connected in this way, the work will not only be heavy but also cumbersome, and the cost will be high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant RNAi binary expression vector with forward and reverse promoters
  • Plant RNAi binary expression vector with forward and reverse promoters
  • Plant RNAi binary expression vector with forward and reverse promoters

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Construction of forward and reverse double promoter plant RNAi binary expression vector

[0026] The present invention is based on the binary vector pBI121 ( figure 1 ) is a new carrier with unique structure and functional characteristics transformed from a skeleton, and its construction method is as follows:

[0027] 1. Obtaining CaMV35S promoter and Nos terminator sequences containing different restriction sites

[0028] ① Design PCR amplification primers at both ends of different CaMV35S promoters as follows:

[0029] The first pair of primers (S1):

[0030] Upstream: A TCTAGA AGATTAGCCTTTTCAATTTC XbaI site (underlined part)

[0031] Downstream: A GGATCC CGTGTTTCTCCAAATGAAA BamHI site (underlined part)

[0032] The second pair of primers (S2):

[0033] Upstream: A GAGCTC AGATTAGCCTTTTCAATTTC SacI site (underlined part)

[0034] Downstream: A GGATCCCTCGAG CGTGTTTCTCTCAAATGAAA BamHI (single underline), XhoI site (double underline)

[0035] ② De...

experiment example

[0060] Experimental example: using the inventive vector to silence the expression of gfp in green fluorescent protein gene (Greenfluorescence protein, gfp)-transformed tobacco leaves through the Agrobacterium transient transformation system.

Embodiment approach

[0062] ① Design the upstream primer P1 (5'-A GGATCC GTGAGCAAGGGCGAGGAGC-3') contains BamHI restriction site and downstream primer P2 (A CTCGAG TTACTTGTACAGCTTGTCCA) contains an XhoI restriction site, and is amplified with the genomic DNA of transgenic tobacco gfp as a template. The amplified 600bp fragment was ligated into the pGEM-T vector, and ligated into the same double-digested vector of the present invention by BamHI / XhoI double enzyme digestion, and the gfp silencing vector was constructed after enzyme digestion confirmed that the vector was correctly connected.

[0063] ② Add 0.1 μg of the constructed gfp silencing vector to 100 μl of Agrobacterium LBA4404 competent cells, freeze in liquid nitrogen for 5 minutes, remove and thaw, add 500 μl of YEB medium, culture on a shaker at 28°C for 4 hours, then centrifuge, remove 400 μl of the supernatant, and 200 μl of resuspended bacteria were all spread on YEB solid medium containing streptomycin (50 mg / L) and kanamycin (50...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relate to 'backward-forward double-promoter plant RNAi double expression vector', its characteristic is contain backward-forward eukaryon expression promoter. The vector realizes the construction process of plant expression vector that can express doubly link RNA through one coupled reaction, which the traditional method needs two or three coupled reaction, saving time and financial resources greatly. The vector can be applied in the study of plant functional genome, virus silence inhibition protein and plant antiviral gene engineering; especially, application in establishing plant functional gene RNA interference base that can silence many gene expression in genome range. Simultaneously, there are adequate single enzyme slice sites in both extremities of every element in the vector expression frame; we can use a suitable element instead of the old element in accordance with experiment request.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a novel eukaryotic expression vector "forward and reverse double promoter plant RNAi binary expression vector" which can be used for plant RNAi research and silence target gene expression. Background technique [0002] RNA interference (RNA interference, RNAi) is the degradation of homologous RNA mediated by double-stranded RNA (double-stranded RNA, dsRNA) in eukaryotes. In cells, the long dsRNA is cut into 21-26 nucleotide (nucleotide, nt) small interfering RNA (small interfering RNA or shortinterfering RNA, siRNA) by Dicer enzyme similar to RNase III. Subsequently, the siRNA binds to the protein complex to form the RNA-induced silencing complex (RISC), and melts. The active RISC binds to its complementary transcript under the guidance of the siRNA reaction chain, resulting in the degradation of RNA. This is a post-transcriptional gene silencing (post-transcriptional gene silence,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82
Inventor燕飞成卓敏张文蔚肖红李世访
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI