Plant RNAi binary expression vector with forward and reverse promoters
A dual expression vector and dual promoter technology, applied in the biological field, can solve the problems of heavy workload, tediousness, and high cost, and achieve the effect of saving time and financial resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Construction of forward and reverse double promoter plant RNAi binary expression vector
[0026] The present invention is based on the binary vector pBI121 ( figure 1 ) is a new carrier with unique structure and functional characteristics transformed from a skeleton, and its construction method is as follows:
[0027] 1. Obtaining CaMV35S promoter and Nos terminator sequences containing different restriction sites
[0028] ① Design PCR amplification primers at both ends of different CaMV35S promoters as follows:
[0029] The first pair of primers (S1):
[0030] Upstream: A TCTAGA AGATTAGCCTTTTCAATTTC XbaI site (underlined part)
[0031] Downstream: A GGATCC CGTGTTTCTCCAAATGAAA BamHI site (underlined part)
[0032] The second pair of primers (S2):
[0033] Upstream: A GAGCTC AGATTAGCCTTTTCAATTTC SacI site (underlined part)
[0034] Downstream: A GGATCCCTCGAG CGTGTTTCTCTCAAATGAAA BamHI (single underline), XhoI site (double underline)
[0035] ② De...
experiment example
[0060] Experimental example: using the inventive vector to silence the expression of gfp in green fluorescent protein gene (Greenfluorescence protein, gfp)-transformed tobacco leaves through the Agrobacterium transient transformation system.
Embodiment approach
[0062] ① Design the upstream primer P1 (5'-A GGATCC GTGAGCAAGGGCGAGGAGC-3') contains BamHI restriction site and downstream primer P2 (A CTCGAG TTACTTGTACAGCTTGTCCA) contains an XhoI restriction site, and is amplified with the genomic DNA of transgenic tobacco gfp as a template. The amplified 600bp fragment was ligated into the pGEM-T vector, and ligated into the same double-digested vector of the present invention by BamHI / XhoI double enzyme digestion, and the gfp silencing vector was constructed after enzyme digestion confirmed that the vector was correctly connected.
[0063] ② Add 0.1 μg of the constructed gfp silencing vector to 100 μl of Agrobacterium LBA4404 competent cells, freeze in liquid nitrogen for 5 minutes, remove and thaw, add 500 μl of YEB medium, culture on a shaker at 28°C for 4 hours, then centrifuge, remove 400 μl of the supernatant, and 200 μl of resuspended bacteria were all spread on YEB solid medium containing streptomycin (50 mg / L) and kanamycin (50...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
