Important controlling gene PIX in anti-tumor immunological reaction

A technology of immune regulation and NK cells, applied in the field of cell biology, can solve problems such as defects in NK cell signaling pathways

Inactive Publication Date: 2007-04-25
SHANGHAI GENOMICS
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

NK cell signaling mediated by 2B4 is defective in XLP patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Important controlling gene PIX in anti-tumor immunological reaction
  • Important controlling gene PIX in anti-tumor immunological reaction
  • Important controlling gene PIX in anti-tumor immunological reaction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Yeast two-hybrid screening and verification

[0045] According to the known SAP gene sequence (GenBank accession number: AL023657), using the lymphocyte cDNA library as a template, using primers 5'ATGGACGCAGTGGCTGTGTATC (SEQ ID NO: 1), 3'TCATGGGGCTTTCAGGCAGAC (SEQ ID NO: 2), by PCR technology Obtain the full length of the SAP gene, connect it to the vector pGB (Clonetech Company) containing the BD functional domain (binding domain) to obtain the plasmid pGB-SAP as bait, and screen the B lymphocytes through the yeast two-hybrid system (Clonetech: yeast-two-hybridsystem2) Cell and T lymphocyte cDNA library, the obtained clones were sequenced and identified as multiple clones of SLAM, 2B4, α-PIX, β-PIX (P21 protein-activated kinase-associated exchange factor). The screening results of the yeast two-hybrid system are shown in Table 1.

[0046] Using the above pGB-SAP wild type as a template, use the point mutation construction kit QuikChangeSite-Directed Mutagene...

Embodiment 2

[0051] Example 2 Verifies the interaction between SAP and β-PIX in mammalian cells

[0052] 1. In mammalian cells, SAP, EAT2 interact with β-PIX

[0053]The SAP and β-PIX gene fragments in the above yeast plasmids pGB-SAP and pACT2-β-PIX were cloned into the eukaryotic expression vector pCDEF containing Flag and HA tag (see US Patent US20020076415A1) to form pCDEF-HA-SAP and pCDEF-Flag-β-PIX. At the same time, according to the known EAT2 gene sequence (GenBank accession number: AF256653), using the lymphocyte cDNA library as a template, using primers 5'ATGGATCTGCCTTACTACCATGGAC (SEQ ID NO: 7), 3'TCAAGGCAAGACATCCACATAATCGC (SEQ ID NO: 8), by PCR Technology Obtain the full length of the EAT2 (SAP analogue in B lymphocytes) gene and clone it into the pCDEF-HA vector to obtain the pCDEF-HA-EAT2 plasmid. The obtained plasmid was co-transfected into mammalian cell 293T (ATCC). After 24 hours of culture, the cells were broken, and the supernatant of the lysate was collected, and wh...

Embodiment 3

[0067] Example 3 Study on the interaction of SAP with β-PIX and Cdc42 by co-immunoprecipitation technique

[0068] 1. Validate the interaction between β-PIX and Cdc42 by co-immunoprecipitation technique

[0069] According to the known Cdc42 (Homo sapiens cell division cycle 42) gene sequence (GenBank accession number: NM_001791), using the lymphocyte cDNA library as a template, primers 5'ATGCAGACAATTAAGTGTGTTGTTGTG (SEQ ID NO: 9); 3' TCATAGCAGCAGCACACACCTGCGG (SEQ ID NO: 10), the full length of the Cdc42 gene was obtained by PCR technology, and connected to the pCDEF-GST vector to obtain pCDEF-GST-Cdc42. Using this as a template, the Cdc42 mutant pCDEF-GST-Cdc42 in the activated state was constructed by the point mutation method (constructed with the SAP point mutation in Example 1) F28L和 Inactive Cdc42 mutant pCDEF-GST-Cdc42 T17N . The pCDEF-GST empty vector, pCDEF-GST-Cdc42, pCDEF-GST-Cdc42 F28L , or pCDEF-GST-Cdc42 T17NCo-transfect mammalian cells 293T with pCDEF-Flag-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for screening compounds with the ability of immune regulating through SAP-PIX-Cdc42 path. The invention also discloses the application of SAP-PIX-Cdc42 path modifier in the preparation of immune regulation drug. The invention confirms the SAP-PIX-Cdc42 path in cell for the first time; thus immunity can be promoted through adjusting the path.

Description

technical field [0001] The invention belongs to the field of cell biology, and relates to a cell channel. More specifically, the invention relates to the application of the SAP-PIX-Cdc42 pathway to the screening of immunomodulatory compounds and the SAP-PIX-Cdc42 pathway modulator in the preparation of immunomodulatory drugs the use of. Background technique [0002] A series of extracellular signals can cause changes in cell behavior, such as cell adhesion, cell division, cell movement, and cell phagocytosis. In this process, small molecule GTPases of the Rho family play an important role. Small molecule GTPases are constantly switching between the GTP-bound active state and the GDP-bound inactive state, and guanosine conversion factor (GEF) catalyzes them into the active state. Various small molecule GTPases have different effects on the cytoskeleton structure, for example, activated RhoA promotes the formation of stress fibers, while activated Cdc42 and Rac1 promote the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/04G01N33/68A61K38/17A61P35/00A61P37/02
Inventor吴骏顾翠萍
OwnerSHANGHAI GENOMICS