Methods for detecting Ehrlichia canis and Ehrlichia chaffensis in vertebrate and invertebrate hosts

a technology of ehrlichia chaffensis, which is applied in the field of methods for detecting ehrlichia canis and ehrlichia chaffensis in vertebrate and invertebrate hosts, can solve the problems of false positives of tests, if a test is conducted without serious limitations, and the dog's infection does not respond well to antibiotics

Inactive Publication Date: 2005-08-04
STICH ROGER +1
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The present invention provides tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal, particularly from a member of the Canidae family. The methods involve amplifying DNA in the sample using a polymerase chain reaction and specific primers, and then detecting the presence of PCR products with a specific length or sequence. The primers are designed to specifically bind to the DNA of E. canis and E. chaffeensis, allowing for the detection of these pathogens in the sample. The technical effect of this invention is the development of reliable tools for the diagnosis and detection of these important pathogens in animals."

Problems solved by technology

However, chronically infected dogs do not respond well to the antibiotic.
The IFA test, however, has serious limitations.
The IFA test is subject to false positives because the antigens are whole infected cells which comprise many nonspecific proteins that can cross-react with sera from some patients.
The IFA test is also subject to false negatives because IFA antigens are unstable and may become inactivated during storage.
Accordingly, serodianosis cannot be used early during the course of infection.
Moreover, serodiagnosis cannot be used for detecting an ongoing infection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for detecting Ehrlichia canis and Ehrlichia chaffensis in vertebrate and invertebrate hosts
  • Methods for detecting Ehrlichia canis and Ehrlichia chaffensis in vertebrate and invertebrate hosts
  • Methods for detecting Ehrlichia canis and Ehrlichia chaffensis in vertebrate and invertebrate hosts

Examples

Experimental program
Comparison scheme
Effect test

example 1

A. Obtaining DNA from Blood Samples of Infected Animals

[0038] Two colony-reared Beagle dogs that were seronegative for exposure to E. canis by IFA were inoculated with heparinized blood from a donor dog infected with E. canis (Ebony isolate). Heparinized blood was collected from each animal and split into 0.5 ml aliquots and subjected to the following treatments: (1) DNAzol extraction of buffy coat, (2) DNAzol-BD (Molecular Research Center) extraction of whole blood, (3) DNAzol-BD extraction of buffy coat, (4) spin-column purification of peripheral blood mononuclear cell DNA with a QIAamp Kit (Qiagen) and (5) phenol / chloroform extraction followed by ethanol precipitation of buffy coat samples. All sample preparation methods were done in duplicate and in two trials. Buffy coats were isolated from the heparinized whole blood after centrifugation at 1000×g for 20 min, except for those to be purified with spin-columns, which were isolated after isopycnic centrifugation as described in...

example 2

[0050]E. chaffeensis p28 ORF sequences were compared to identify prospective oligonucleotide primer sequences for a PCR assay. Design of the primers for this PCR assay was similar to that described for E. canis, except that identities of these primers to the three clusters of p28 sequences among the E chaffeensis isolates were also considered by dividing the product of the annealing and E. canis identity scores by the mean of the three E. chaffeensis cluster identity scores. Primers were designed from the E. chaffeensis Arkansas isolate p28 sequence. These primer sequences were aligned with the homologous portions of the E. canis p30 geme and the three p28 clusters and the identity of these sequences determined Total annealing scores, identity to the different p28 clusters and identity to p30 were then used to rank these primer sets. A second approach to primer design involved the design of primers to the consensus sequence of all three E. chaffeensis p28 clusters through less strin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
volumesaaaaaaaaaa
volumesaaaaaaaaaa
lengthaaaaaaaaaa
Login to View More

Abstract

Tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal are provided. The methods employ a polymerase chain reaction and primer sets that are based on the p30 gene of E. canis and the p28 gene of E. chaffeensis. The present invention also relates to the p30 and the p28 primer sets. Each p30 primer set comprises a first primer and the second primer, both of which are from 15 to 35 nucleotides in length. The first p30 primer comprises a sequence which is complementary to a consecutive sequence, within the following sequence: CCA AGTGTCTCAC ATTTTGGTAG CTTCTCAGCT AAAGAAGAAA GCAAATCAAC TGTTGGAGTTTTTGGATTAA AACATGATTG GGATGGAAGT CCAATACTTA AGAATAAACA CGCTGACTTTACTGTTCCAA AC. SEQ ID NO.1. The second p30 primer comprises a sequence which is complementary to the inverse complement of a consecutive sequence contained within the following sequence: GTTACT CAATGGGTGG CCCAAGAATA GAATTCGAAA TATCTTATGA AGCATTCGAC GTAAAAAGTC CTAATATCAA TTATCAAAAT GACGCGCACA GGTACTGCGC TCTATCTCAT CACACATCGG CAGCCAT, SEQ ID NO.2. The first p28 comprises a sequence which is complementary to a consecutive sequenc, within the following sequence: A GTTTTCATAA CAAGTGCATT GATATCACTA ATATCTTCTC TACCTGGAGT ATCATTTTCC GACCCAACAG GTAGTGGTAT TAACGG, SEQ ID NO. 3. The second p28 primercomprises a sequence which is complementary to the inverse complement of a consecutive sequencewithin one of the following two sequences: CAT TTCTAGGTTT TGCAGGAGCT ATTGGCTACT CAATGGATGG TCCAAGAATA GAGCTTGAAG TATCTTATGA, SEQ ID NO. 4, or C AAGGAAAGTT AGGTTTAAGC TACTCTATAA GCCCAGA, SEQ ID NO. 5.

Description

BACKGROUND OF THE INVENTION [0001] The Ehrlichiae are obligate intracellular bacteria found in circulating leukocytes of infected animals. Ehrlichia canis (E. canis) infects monocytes and causes ehrlichiosis in animals belonging to the family Canidae. E. canis is transmitted by the brown dog tick, Rhipicephalus sanguineus. [0002] Canine monocytic ehrlichiosis (CME) consists of an acute and a chronic phase. The acute phase is characterized by fever, serous nasal and ocular discharges, anorexia, depression, and loss of weight. The chronic phase is characterized by severe pancytopenia, epistaxis, hematuria, blood in feces in addition to more severe clinical signs of the acute disease. If treated early during the course of the disease, dogs respond well to doxycycline. However, chronically infected dogs do not respond well to the antibiotic. Therefore, early diagnosis is very important for treating canine ehrlichiosis. [0003] Human monocytic ehrlichiosis (HME) is a tick-borne, emerging ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68
CPCC12Q1/689
InventorSTICH, ROGERRIKIHISA, YASUKO
OwnerSTICH ROGER