Methods for detecting Ehrlichia canis and Ehrlichia chaffensis in vertebrate and invertebrate hosts

Abstract

Tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal are provided. The methods employ a polymerase chain reaction and primer sets that are based on the p30 gene of E. canis and the p28 gene of E. chaffeensis. The present invention also relates to the p30 and the p28 primer sets. Each p30 primer set comprises a first primer and the second primer, both of which are from 15 to 35 nucleotides in length. The first p30 primer comprises a sequence which is complementary to a consecutive sequence, within the following sequence: CCA AGTGTCTCAC ATTTTGGTAG CTTCTCAGCT AAAGAAGAAA GCAAATCAAC TGTTGGAGTTTTTGGATTAA AACATGATTG GGATGGAAGT CCAATACTTA AGAATAAACA CGCTGACTTTACTGTTCCAA AC. SEQ ID NO.1. The second p30 primer comprises a sequence which is complementary to the inverse complement of a consecutive sequence contained within the following sequence: GTTACT CAATGGGTGG CCCAAGAATA GAATTCGAAA TATCTTATGA AGCATTCGAC GTAAAAAGTC CTAATATCAA TTATCAAAAT GACGCGCACA GGTACTGCGC TCTATCTCAT CACACATCGG CAGCCAT, SEQ ID NO.2. The first p28 comprises a sequence which is complementary to a consecutive sequenc, within the following sequence: A GTTTTCATAA CAAGTGCATT GATATCACTA ATATCTTCTC TACCTGGAGT ATCATTTTCC GACCCAACAG GTAGTGGTAT TAACGG, SEQ ID NO. 3. The second p28 primercomprises a sequence which is complementary to the inverse complement of a consecutive sequencewithin one of the following two sequences: CAT TTCTAGGTTT TGCAGGAGCT ATTGGCTACT CAATGGATGG TCCAAGAATA GAGCTTGAAG TATCTTATGA, SEQ ID NO. 4, or C AAGGAAAGTT AGGTTTAAGC TACTCTATAA GCCCAGA, SEQ ID NO. 5.

Description

BACKGROUND OF THE INVENTION [0001] The Ehrlichiae are obligate intracellular bacteria found in circulating leukocytes of infected animals. Ehrlichia canis (E. canis) infects monocytes and causes ehrlichiosis in animals belonging to the family Canidae. E. canis is transmitted by the brown dog tick, Rhipicephalus sanguineus. [0002] Canine monocytic ehrlichiosis (CME) consists of an acute and a chronic phase. The acute phase is characterized by fever, serous nasal and ocular discharges, anorexia, depression, and loss of weight. The chronic phase is characterized by severe pancytopenia, epistaxis, hematuria, blood in feces in addition to more severe clinical signs of the acute disease. If treated early during the course of the disease, dogs respond well to doxycycline. However, chronically infected dogs do not respond well to the antibiotic. Therefore, early diagnosis is very important for treating canine ehrlichiosis. [0003] Human monocytic ehrlichiosis (HME) is a tick-borne, emerging ...

AI Technical Summary

Benefits of technology

"The present invention provides tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal, particularly from a member of the Canidae family. The methods involve amplifying DNA in the sample using a polymerase chain reaction and specific primers, and then detecting the presence of PCR products with a specific length or sequence. The primers are designed to specifically bind to the DNA of E. canis and E. chaffeensis, allowing for the detection of these pathogens in the sample. The technical effect of this invention is the development of reliable tools for the diagnosis and detection of these important pathogens in animals."

Problems solved by technology

However, chronically infected dogs do not respond well to the antibiotic.

The IFA test, however, has serious limitations.

The IFA test is subject to false positives because the antigens are whole infected cells which comprise many nonspecific proteins that can cross-react with sera from some patients.

The IFA test is also subject to false negatives because IFA antigens are unstable and may become inactivated during storage.

Accordingly, serodianosis cannot be used early during the course of infection.

Moreover, serodiagnosis cannot be used for detecting an ongoing infection.

Images