Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

31 results about "Ehrlichia canis" patented technology

Ehrlichia canis is an obligate intracellular bacterium that acts as the causative agent of ehrlichiosis, a disease most commonly affecting canine species. This pathogen is present throughout the United States (but is most prominent in the South), South America, Asia, and Africa. First defined in 1935, E. canis emerged in the United States in 1963 and its presence has since been found in all 48 contiguous United States. Reported primarily in dogs, E. canis has also been documented in felines and humans, where it is transferred most commonly via Rhipicephalus sanguineus, the brown dog tick.

Homologous 28-kilodalton immunodominant protein genes of Ehrlicha canis and uses thereof

The present invention is directed to the cloning, sequencing and expression of homologous immunoreactive 28-kDa protein genes, p28-1, -2, -3, -5, -6, -7, -9, from a polymorphic multiple gene family of Ehrlichia canis. Further disclosed is a multigene locus encoding all nine homologous 28-kDa protein genes of Ehrlichia canis. Recombinant Ehrlichia canis 28-kDa proteins react with convalescent phase antiserum from an E. canis-infected dog, and may be useful in the development of vaccines and serodiagnostics that are particularly effective for disease prevention and serodiagnosis.
Owner:RES DEVMENT FOUND

P153 and P156 antigens for the immunodiagnosis of canine and human ehrlichioses and uses thereof

Sequences encoding two immunoreactive glycoproteins were cloned from Ehrlichia canis (p153 gene) and Ehrlichia chaffeensis (p156 gene). These two glycoproteins are species-specific immunoreactive orthologs that are useful as subunit vaccines and for serologic and molecular diagnostics for E. canis and E. chaffeensis.
Owner:RES DEVMENT FOUND

P153 and P156 antigens for the immunodiagnosis of canine and human ehrlichioses and uses thereof

Sequences encoding two immunoreactive glycoproteins were cloned from Ehrlichia canis (p153 gene) and Ehrlichia chaffeensis (p156 gene). These two glycoproteins are species-specific immunoreactive orthologs that are useful as subunit vaccines and for serologic and molecular diagnostics for E. canis and E. chaffeensis.
Owner:RES DEVMENT FOUND

Ehrlichia canis genes and vaccines

This invention provides the sequence of 5,299 nucleotides from the E. canis genome. There are four proteins, ProA, ProB, MmpA, and a cytochrome oxidase homolog, as well as a partial lipoprotein signal peptidase homolog at the carboxy terminus, coded for in this cloned fragment. The antigenic properties of these proteins allow them to be used to create a vaccine. An embodiment of this invention includes the creation of a DNA vaccine, a recombinant vaccine, and a T cell epitope vaccine. Another embodiment of this invention includes the use of serological diagnosis techniques.
Owner:CORNELL RES FOUNDATION INC

Immunoreactive 38-KDA ferric binding protein of ehrlichia canis and uses thereof

The present invention is directed to the cloning, sequencing, expression, and characterization of an immunoreactive ferric binding protein (Fbp) (38-kDa) protein of Ehrlichia canis encoded by a polynucleotide therefor. In particular embodiments, the protein is employed in an immunogenic composition, such as a vaccine. Methods to induce an immune reaction in an individual with compositions of the invention are provided.
Owner:RES DEVMENT FOUND

Compositions and methods to detect various infectious organisms

The invention relates to compositions and methods for the detection of various infectious organisms, including heartworm (Dirofilaria immitis), Ehrlichia Canis, Anaplasma phagocytophilum, and Borrelia burgdorferi. More particularly, this invention relates to antibodies that bind to a heartworm antigen, the E. Canis gp36 polypeptide, the A. phagocytophilum p44 polypeptide, the B. burgdorferi OspA, OspC, OspF, p39, p41 and VlsE polypeptides, and uses thereof.
Owner:VCA

Attenuated ehrlichiosis vaccine

The present invention relates to an attenuated strain of Ehrlichia canis and a vaccine comprising said attenuated strain for protection of mammals against ehrlichiosis. The invention further relates to methods of preventing ehrlichiosis and of attenuating the pathogenicity Ehrlichia canis.
Owner:YISSUM RES DEV CO OF THE HEBREWUNIVERSITY OF JERUSALEM LTD

Targeted gene disruption methods and immunogenic compositions

PendingCN110913877AReduce incidenceReduce severityAntibacterial agentsBacteriaRickettsiaAnaplasma phagocytophilum DNA
Targeted disruption of a specific gene and its subsequent restoration in obligate intracellular bacteria remains extremely challenging due to their absolute requirement for residence inside a host cell to replicate. Here, targeted allelic exchange mutations were created to inactivate two genes and then to restore one of the two genes of a rickettsial pathogen, Ehrlichia chaffeensis. These methodswere then also successfully utilized in Ehrlichia canis and Anaplasma phagocyophilum. The resultant mutated pathogens are useful in immunogenic compositions for reducing the incidence of or severity of infection with ricksettsial pathogens.
Owner:KANSAS STATE UNIV RES FOUND

Method for continuously culturing Ehrlichia canis

The present invention relates to a method of culturing bacterial organisms belonging to the family Anaplasmataceae in mammalian embryonic or fetal cells. In particular, the present invention is directed to growth of bacterial organisms belonging to the family Anaplasmataceae including organisms belonging to the Anaplasma, Ehrlichia and Neorickettsia genera. The bacterial organisms may be cultured in mammalian embryonic or fetal host cells including feline embryonic host cells. Bacterial material cultured according to the methods described herein may be used as the basis for vaccines against diseases associated with the Anaplasmataceae bacteria, or as the basis for diagnostic applications useful for diagnosing diseases associated with the Anaplasmataceae bacteria.
Owner:INTERVET INC

Ehrlichia canis genes and vaccines

This invention provides the sequence of 5,299 nucleotides from the E. canis genome. There are four proteins, ProA, ProB, MmpA, and a cytochrome oxidase homolog, as well as a partial lipoprotein signal peptidase homolog at the carboxy terminus, coded for in this cloned fragment. The antigenic properties of these proteins allow them to be used to create a vaccine. An embodiment of this invention includes the creation of a DNA vaccine, a recombinant vaccine, and a T cell epitope vaccine. Another embodiment of this invention includes the use of serological diagnosis techniques.
Owner:CORNELL RES FOUNDATION INC

Method for continuously culturing ehrlichia canis

The present invention relates to a method of culturing bacterial organisms belonging to the family Anaplasmataceae in mammalian embryonic or fetal cells. In particular, the present invention is directed to growth of bacterial organisms belonging to the family Anaplasmataceae including organisms belonging to the Anaplasma, Ehrlichia and Neorickettsia genera. The bacterial organisms may be cultured in mammalian embryonic or fetal host cells including feline embryonic host cells. Bacterial material cultured according to the methods described herein may be used as the basis for vaccines against diseases associated with the Anaplasmataceae bacteria, or as the basis for diagnostic applications useful for diagnosing diseases associated with the Anaplasmataceae bacteria.
Owner:INTERVET INC

Immunoreactive ehrlichia p120/p140 epitopes and uses thereof

Provided herein are immunoreactive peptides which can selectively bind Ehrlichia-specific anti-p120 or anti-p140 antibodies. Methods and kits utilizing the immunoreactive peptides are also provided. The immunoreactive peptides may be utilized, e.g., for determining whether or not a subject is infected with Ehrlichia chaffeensis or Ehrlichia canis. In certain embodiments, the immunoreactive peptides may be utilized in an ELISA or lateral flow assay.
Owner:RES DEVMENT FOUND

Methods for detecting Ehrlichia canis and Ehrlichia chaffensis in vertebrate and invertebrate hosts

Tools and methods for detecting the presence of E. canis and E. chaffeensis in a sample obtained from an animal are provided. The methods employ a polymerase chain reaction and primer sets that are based on the p30 gene of E. canis and the p28 gene of E. chaffeensis. The present invention also relates to the p30 and the p28 primer sets. Each p30 primer set comprises a first primer and the second primer, both of which are from 15 to 35 nucleotides in length. The first p30 primer comprises a sequence which is complementary to a consecutive sequence, within the following sequence: CCA AGTGTCTCAC ATTTTGGTAG CTTCTCAGCT AAAGAAGAAA GCAAATCAAC TGTTGGAGTTTTTGGATTAA AACATGATTG GGATGGAAGT CCAATACTTA AGAATAAACA CGCTGACTTTACTGTTCCAA AC. SEQ ID NO.1. The second p30 primer comprises a sequence which is complementary to the inverse complement of a consecutive sequence contained within the following sequence: GTTACT CAATGGGTGG CCCAAGAATA GAATTCGAAA TATCTTATGA AGCATTCGAC GTAAAAAGTC CTAATATCAA TTATCAAAAT GACGCGCACA GGTACTGCGC TCTATCTCAT CACACATCGG CAGCCAT, SEQ ID NO.2. The first p28 comprises a sequence which is complementary to a consecutive sequenc, within the following sequence: A GTTTTCATAA CAAGTGCATT GATATCACTA ATATCTTCTC TACCTGGAGT ATCATTTTCC GACCCAACAG GTAGTGGTAT TAACGG, SEQ ID NO. 3. The second p28 primercomprises a sequence which is complementary to the inverse complement of a consecutive sequencewithin one of the following two sequences: CAT TTCTAGGTTT TGCAGGAGCT ATTGGCTACT CAATGGATGG TCCAAGAATA GAGCTTGAAG TATCTTATGA, SEQ ID NO. 4, or C AAGGAAAGTT AGGTTTAAGC TACTCTATAA GCCCAGA, SEQ ID NO. 5.
Owner:STICH ROGER +1

Primer pair, kit and method for detecting ehrlichia canis

ActiveUS20180080066A1Rapidly and accurately diagnoseHigh sensitivityMicrobiological testing/measurementForward primerGenetics
Primer pair, kit and method for detecting Ehrlichia Canis are disclosed. The primer pair includes a forward primer and a reverse primer, and the kit includes the primer pair and a probe. The forward primer has a sequence of SEQ ID NO: 1, the reverse primer has a sequence of SEQ ID NO: 2, and the probe has a sequence of SEQ ID NO: 3.
Owner:REVISION EYEWEAR +1

Ehrlichia disulfide bond formation proteins and uses thereof

Novel genes encoding homologous immunoreactive thio-disulfide oxidoreductases, or disulfide bond formation (Dsb) proteins from Ehrlichia chaffeensis and Ehrlichia canis are disclosed. While the E. chaffeensis and E. canis Dsb proteins are at most only 31% or less homologous to other known Dsb proteins, the Ehrlichia Dsbs contain a cysteine active site, Cys-Gly-Tyr-Cys, similar to those in known Dsb proteins. As predicted by 15-amino acid identical N-terminal signal peptides, the proteins are primarily localized in the periplasm of E. chaffeensis and E. canis, possibly playing a role in antigenicity and pathogenesis. The present invention provides the nucleotide and amino acid sequences and expression vectors for the E. chaffeensis and E. canis dsb genes, antisera directed against the proteins, and kits to determine whether an individual or animal is infected with a given species of Ehrlichia.
Owner:RES DEVMENT FOUND

Ehrlichia ruminantium immunogenic compositions and methods of using thereof

The present disclosure provides compositions and methods for reducing the incidence of and / or severity of diseases associated with tick-borne pathogens. In preferred forms, the compositions comprise a recombinant antigenic protein subunit that has been glycosylated. Some preferred subunits include the MAP1 protein of Ehrlichia ruminantium, the p30-1 sequence from Ehrlichia canis, the p28-Omp19 protein from Ehrlichia chaffeensis, and the MSP4 protein from Anaplasma marginale. Administration of such compositions to an animal in need thereof provides protection against clinical signs of infection in susceptible animals.
Owner:KANSAS STATE UNIV RES FOUND

Ehrlichia disulfide bond formation proteins and uses thereof

Novel genes encoding homologous immunoreactive thio-disulfide oxidoreductases, or disulfide bond formation (Dsb) proteins from Ehrlichia chaffeensis and Ehrlichia canis are disclosed. While the E. chaffeensis and E. canis Dsb proteins are at most only 31% or less homologous to other known Dsb proteins, the Ehrlichia Dsbs contain a cysteine active site, Cys-Gly-Tyr-Cys, similar to those in known Dsb proteins. As predicted by 15-amino acid identical N-terminal signal peptides, the proteins are primarily localized in the periplasm of E. chaffeensis and E. canis, possibly playing a role in antigenicity and pathogenesis. The present invention provides the nucleotide and amino acid sequences and expression vectors for the E. chaffeensis and E. canis dsb genes, antisera directed against the proteins, and kits to determine whether an individual or animal is infected with a given species of Ehrlichia.
Owner:RES DEVMENT FOUND

Vaccine against Ehrlichia canis

Vaccine and / or immunogenic compositions that comprise an effective immunizing amount of an antigen from E. canis are described. In addition, methods of immunizing a subject against E. canis by providing the vaccine and / or immunogenic compositions are also disclosed.
Owner:BOARD OF SUPERVISORS OF LOUISIANA STATE UNIV & AGRI & MECHANICAL COLLEGE +1

A high-throughput visual chip for rapid detection of Rickettsia and its application

The invention relates to the field of molecular biology, and specifically discloses a chip for high-throughput visual rapid detection of rickettsia and its application. The invention aims at realizing high-throughput species- and genus-specific detection by designing rickettsia genus-specific and species-specific probes. And by artificially synthesizing biotin-labeled primers and probes, using streppenicillin-horseradish peroxidase to combine with labeled biotin, and further performing color reaction with precipitated TMB to obtain visual detection results. The present invention can be used for the rapid diagnosis of following 10 kinds of rickettsias: Rickettsia praustii, Rickettsia moschii, Rickettsia consoni, Rickettsia heilongjiang, Rickettsia rickettsia, Siberia Rickettsia, Ehrlichia chaffeensis, Ehrlichia canis, Orientia tsutsugamushi, and Coxiella beinii.
Owner:CHINA AGRI UNIV

Homologous 28-kilodalton immunodominant protein genes of Ehrlichia canis and uses thereof

The present invention is directed to the cloning, sequencing and expression of homologous immunoreactive 28-kDa protein genes, p28-1, -2, -3, -5, -6, -7, -9, from a polymorphic multiple gene family of Ehrlichia canis. Further disclosed is a multigene locus encoding all nine homologous 28-kDa protein genes of Ehrlichia canis. Recombinant Ehrlichia canis 28-kDa proteins react with convalescent phase antiserum from an E. canis-infected dog, and may be useful in the development of vaccines and serodiagnostics that are particularly effective for disease prevention and serodiagnosis.
Owner:RES DEVMENT FOUND

Primer pair, kit and method for detecting Ehrlichia canis

Primer pair, kit and method for detecting Ehrlichia canis are disclosed. The primer pair includes a forward primer and a reverse primer, and the kit includes the primer pair and a probe. The forward primer has a sequence of SEQ ID NO: 1, the reverse primer has a sequence of SEQ ID NO: 2, and the probe has a sequence of SEQ ID NO: 3.
Owner:REVISION EYEWEAR +1

Immunoreactive 38-KDA ferric binding protein of ehrlichia canis and uses thereof

The present invention is directed to the cloning, sequencing, expression, and characterization of an immunoreactive ferric binding protein (Fbp) (38-kDa) protein of Ehrlichia canis encoded by a polynucleotide therefor. In particular embodiments, the protein is employed in an immunogenic composition, such as a vaccine. Methods to induce an immune reaction in an individual with compositions of the invention are provided.
Owner:RES DEVMENT FOUND
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More