Renal progenitor cells from embryonic stem cells

Inactive Publication Date: 2007-02-08
RGT UNIV OF MICHIGAN
View PDF0 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the efforts of the prior art have all failed to evoke tubular epithelia in renal cell cultures.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Renal progenitor cells from embryonic stem cells
  • Renal progenitor cells from embryonic stem cells
  • Renal progenitor cells from embryonic stem cells

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0073] This example describes cell culture and microinjection techniques utilized in experiments conducted during the course of the present invention. Mouse ES cells (R26) were grown in high glucose DMEM (GIBCO BRL), 10% fetal bovine serum (Atlanta Biologicals), 0.1 mM β-mercaptoethanol (Sigma), 4 mM glutamine (GIBCO BRL), 20 unit / ml PEN / STREP (GIBCO BRL), 0.1 mg / ml G418 (GIBCO BRL), and 103 unit / ml rLIF (Chemicon) on a 0.1% gelatin-coated tissue culture plate at 37° C. CO2 incubator for 2 days. The ES cells were transferred using 0.05% trypsin plus 0.53 mM EDTA (GIBCO BRL) to a 100-mm bacteriological petri dish (Falcon) to induce embryoid body (EB) formation. The EB suspension was cultured in the same medium without rLIF for 2 days and then transferred to 60-mm tissue culture plates coated with 0.1% gelatin. Each 60-mm tissue culture plate contained about 100 EBs. The EBs were grown without growth factors or in the presence of the following growth factors: 0.1 μM retinoic acid (RA)...

example ii

[0074] This example describes a reverse transcription-PCR (RT-PCR) analysis technique utilized in experiments conducted during the course of the present invention. Total RNA was extracted by using TRIZOL reagent (GIBCO BRL). One unit of DNase I (Boehringer Mannheim) was added to 1 μg RNA and the mixture was incubated at 37° C. for 30 min. The isolated RNA by phenol / chloroform method was used for RT-PCR template. Superscript™ One-Step RT-PCR with Platinum Taq (Invitrogen) was utilized for cDNA synthesis and PCR amplification in a Peltier Thermal Cycler (MJ Research). The primer pairs for RT-PCR were as follows:

Pax-2:(SEQ ID NO: 1)CAGCCTTTCCACCCAACG,GTGGCGGTCATAGGCAGCLim-1:(SEQ ID NO: 2)CAAAGAGAACAGCCTCCACTCG,GGATGTGCCAGGATGTCAGTAAATCgdnf:(SEQ ID NO: 3)AAGGTCACCAGATAAACAAGCGG,CATAGCCCAAACCCAAGTCAGTGEya1:(SEQ ID NO: 4)CTAACCAGCCCGCATAGCCG,TAGTTTGTGAGGAAGGGGTAGGSix2:(SEQ ID NO: 5)GCACCTCCACAAGAATGAAAGC,TGAGCAACAGAGCGGGACTGwnt4:(SEQ ID NO: 8)AACTGGAGAAGTGTGGCTGTGACCG,(SEQ ID NO: 7)CATC...

example iii

[0075] This example describes immunohistochemistry techniques utilized in experiments conducted during the course of the present invention. Embryoid bodies were fresh frozen in OCT and sectioned at 10 microns in a cryostat. After air drying, sections were fixed in 3% PFA for 10 min and washed in PBS, 0.1% Tween 20 (PBST). Antibodies were incubated for 2 h at room temperature in PBST, 2% goat serum. Primary antibodies used were: rabbit anti-Pax2 (Covance Inc.), mouse anti-pan-cytokeratin (Sigma), mouse anti-E-cadherin (Cell Signaling Technology), mouse anti-b-catenin (Cell Signaling Technology), rabbit anti-laminin (Sigma), and FITC-lotus tetragonobulus agglutinin (LTA, Sigma). After washing two times in PBST, fluorescent conjugated secondary antibodies were used. Images were captured on a Nikon ES800 fluorescent scope with a SPOT digital camera.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to compositions and methods for inducing the differentiation of stem cells into renal progenitor cells. In particular, the present invention provides compositions containing activin-a, retinoic acid, and bmp-7, and variants thereof, for differentiating stem cells into renal cells containing tubular epithelia. In certain embodiments, the present invention provides stem cells cultured with compositions used to treat renal disease.

Description

[0001] This application claims priority to U.S. Provisional Application Ser. No. 60 / 700,234, filed Jul. 18, 2005, which is herein incorporated by reference in its entirety.[0002] The present application was funded in part with government support under grant number DK069689 from the National Institutes of Health. The government may have certain rights in this invention.FIELD OF THE INVENTION [0003] The present invention relates to compositions and methods for inducing the differentiation of stem cells into renal progenitor cells. In particular, the present invention provides compositions containing activin-a, retinoic acid, and bmp-7, and variants thereof, for differentiating stem cells into renal cells containing tubular epithelia. In certain embodiments, the present invention provides stem cells cultured with compositions used to treat renal disease. BACKGROUND OF THE INVENTION [0004] Kidney disease is a major health problem in the United States, afflicting some eight million Ameri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/08C12N5/071
CPCC12N5/0686C12N2501/155C12N2506/02C12N2501/385C12N2501/16
InventorDRESSLER, GREGORYKIM, DOYEOB
OwnerRGT UNIV OF MICHIGAN