Modulation of telomere length by oligonucleotides having a G-core sequence

a technology of telomere length and oligonucleotide, which is applied in the direction of transferases, peptide/protein ingredients, drug compositions, etc., can solve the problems of undiscovered effective methods for controlling aging process or cancer, and achieve the effect of modulating telomere length and inhibiting pla2 enzyme activity

Inactive Publication Date: 2007-11-22
IONIS PHARMA INC
View PDF66 Cites 34 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent text describes the discovery of certain sequences of DNA that can prevent the length of chromosomes' ends (known as telomeres) from getting too long. These sequences, called oligonucleotides, can be used to treat diseases associated with excessive cell division, such as cancer, and to slow down the aging process. The patent also provides methods for using these sequences to modulate telomere length and inhibit the growth of malignant cells.

Problems solved by technology

While this research suggests that telomere length affects cell division, no effective method for control of the aging process or cancer has been discovered.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

example 1

Oligonucleotide Synthesis

[0043] Oligonucleotides may be purchased commercially or synthesized as follows. DNA synthesizer reagents, controlled-pore glass (CPG)-bound and B-cyanoethyldiisopropylphosphoramidites were purchased from Applied Biosystems (Foster City, Calif.). 2′-O-Methyl B-cyanoethyldiisopropylphosphoramidites were purchased from Chemgenes (Needham, Mass.). Phenoxyacetyl-protected phosphoramadites for RNA synthesis were purchased from BioGenex (Hayward, Calif.).

[0044] Oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems model 380B). 2′-O-Methyl oligonucleotides were synthesized using the standard cycle for unmodified oligonucleotides, except the wait step after pulse delivery of tetrazole and base was increased to 360 seconds. The 3′ base bound to the CPG used to start the synthesis was a 2′-deoxyribonucleotide. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55° C. (18 hours), the oligonucleotide...

example 2

Modulation of Telomere Length by G4 Phosphorothioate Oligonucleotides

[0045] The amount and length of telomeric DNA in human fibroblasts has been shown to decrease during aging as a function of serial passage in vitro. To examine the effect of G4 phosphorothioate oligonucleotides on this process, human skin biopsy fibroblasts are grown as described in Harley, C. B., Meth. Molec. Biol. 1990, 5, 25-32. Cells are treated with the oligonucleotides shown in Table 1, by adding the oligonucleotide to the medium to give a final concentration of 1 μM, 3 μM or 10 μM; control cells receive no oligonucleotide. Population doublings are counted and DNA is isolated at regular intervals. Telomere length is determined by Southern blot analysis and plotted against number of population doublings as described in Harley, C. B. et al., Nature 1990, 345, 458-460. The slope of the resulting linear regression lines indicates a loss of approximately 50 bp of telomere DNA per mean population doubling in untre...

example 3

Chimeric 2′-O-methyl G4 Oligonucleotides with Deoxy Gaps

[0046] A series of phosphorothioate oligonucleotides were synthesized having a 2′-O-methyl substitution on the sugar of each nucleotide in the flanking regions, and 2′-deoxynucleotides in the center portion of the oligonucleotide (referred to as the “deoxy gap”). Deoxy gaps varied from zero to seven nucleotides in length. Additional chimeric oligonucleotides were synthesized having the sequences GTTGGAGACCGGGGTTGGGG (SEQ ID NO:5) and CACGGGGTCGCCGATGAACC (SEQ ID NO:6). These oligonucleotides were 2′-O-methyl oligonucleotides with deoxy gaps as described above, but instead of a uniform phosphorothioate backbone, these compounds had phosphorothioate internucleotide linkages in the deoxy gap region and phosphodiester linkages in the flanking region.

[0047] Additional oligonucleotides were synthesized with 2′-O-propyl modifications. 2′-O-propyl oligonucleotides were prepared from 2′-deoxy-2′-O-propyl ribosides of nucleic acid base...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
telomere lengthaaaaaaaaaa
Telomere Lengthaaaaaaaaaa
Login to View More

Abstract

Modified oligonucleotides having a GGG motif sequence and a sufficient number of flanking nucleotides to modulate the telomere length of a chromosome are provided. Methods of modulating telomere length of a mammalian chromosome in vitro and in vivo are also provided, as are methods for inhibiting the division of a malignant mammalian cell and for modulating the effects of cellular aging.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] The present application is a continuation in part of U.S. application Ser. No. 11 / 436,901 filed May 17, 2006, which is a continuation-in-part of U.S. application Ser. No. 10 / 038,335, filed Jan. 2, 2002, which is U.S. Pat. No. 7,067,497 and which is a continuation-in-part of U.S. application Ser. No. 09 / 299,058, filed Apr. 23, 1999, now abandoned, which is a continuation of U.S. application Ser. No. 08 / 403,888 filed Jun. 12, 1995, which is U.S. Pat. No. 5,952,490, the U.S. national phase of PCT Application Serial No. PCT / US93 / 09297 filed Sep. 29, 1993, which is a continuation-in-part of U.S. application Ser. No. 07 / 954,185 filed Sep. 29, 1992, now abandoned, each of which is incorporated herein by reference in its entirety.FIELD OF THE INVENTION [0002] This invention relates to the design and synthesis of oligonucleotides which can be used to modulate telomere length in vivo or in vitro. These compounds can be used prophylactically or th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61K48/00A01N43/04C12N15/09A01N63/00A61K31/70A61K38/00A61P31/12A61P31/16A61P35/00C07H21/00C07H21/04C12N15/113C12N15/115C12N15/117C12P19/34C12Q1/68C12Q1/70
CPCA61K31/70A61K38/00C12Y301/01004C07H21/00C12N15/1133C12N15/1137C12N15/115C12N15/117C12N2310/151C12N2310/18C12N2310/315C12N2310/321C12N2310/341C12N2310/346C12Q1/701C12Y207/07049C12N2310/3521A61P31/12A61P31/16A61P31/18A61P31/22A61P35/00C12Q1/70A01N43/04C12Q1/68
InventorBENNETT, C. FRANKECKER, DAVID J.VICKERS, TIMOTHYWYATT, JACQUELINE R.
OwnerIONIS PHARMA INC