Modulation of telomere length by oligonucleotides having a G-core sequence
a technology of telomere length and oligonucleotide, which is applied in the direction of transferases, peptide/protein ingredients, drug compositions, etc., can solve the problems of undiscovered effective methods for controlling aging process or cancer, and achieve the effect of modulating telomere length and inhibiting pla2 enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
example 1
Oligonucleotide Synthesis
[0043] Oligonucleotides may be purchased commercially or synthesized as follows. DNA synthesizer reagents, controlled-pore glass (CPG)-bound and B-cyanoethyldiisopropylphosphoramidites were purchased from Applied Biosystems (Foster City, Calif.). 2′-O-Methyl B-cyanoethyldiisopropylphosphoramidites were purchased from Chemgenes (Needham, Mass.). Phenoxyacetyl-protected phosphoramadites for RNA synthesis were purchased from BioGenex (Hayward, Calif.).
[0044] Oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems model 380B). 2′-O-Methyl oligonucleotides were synthesized using the standard cycle for unmodified oligonucleotides, except the wait step after pulse delivery of tetrazole and base was increased to 360 seconds. The 3′ base bound to the CPG used to start the synthesis was a 2′-deoxyribonucleotide. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55° C. (18 hours), the oligonucleotide...
example 2
Modulation of Telomere Length by G4 Phosphorothioate Oligonucleotides
[0045] The amount and length of telomeric DNA in human fibroblasts has been shown to decrease during aging as a function of serial passage in vitro. To examine the effect of G4 phosphorothioate oligonucleotides on this process, human skin biopsy fibroblasts are grown as described in Harley, C. B., Meth. Molec. Biol. 1990, 5, 25-32. Cells are treated with the oligonucleotides shown in Table 1, by adding the oligonucleotide to the medium to give a final concentration of 1 μM, 3 μM or 10 μM; control cells receive no oligonucleotide. Population doublings are counted and DNA is isolated at regular intervals. Telomere length is determined by Southern blot analysis and plotted against number of population doublings as described in Harley, C. B. et al., Nature 1990, 345, 458-460. The slope of the resulting linear regression lines indicates a loss of approximately 50 bp of telomere DNA per mean population doubling in untre...
example 3
Chimeric 2′-O-methyl G4 Oligonucleotides with Deoxy Gaps
[0046] A series of phosphorothioate oligonucleotides were synthesized having a 2′-O-methyl substitution on the sugar of each nucleotide in the flanking regions, and 2′-deoxynucleotides in the center portion of the oligonucleotide (referred to as the “deoxy gap”). Deoxy gaps varied from zero to seven nucleotides in length. Additional chimeric oligonucleotides were synthesized having the sequences GTTGGAGACCGGGGTTGGGG (SEQ ID NO:5) and CACGGGGTCGCCGATGAACC (SEQ ID NO:6). These oligonucleotides were 2′-O-methyl oligonucleotides with deoxy gaps as described above, but instead of a uniform phosphorothioate backbone, these compounds had phosphorothioate internucleotide linkages in the deoxy gap region and phosphodiester linkages in the flanking region.
[0047] Additional oligonucleotides were synthesized with 2′-O-propyl modifications. 2′-O-propyl oligonucleotides were prepared from 2′-deoxy-2′-O-propyl ribosides of nucleic acid base...
PUM
Property | Measurement | Unit |
---|---|---|
length | aaaaa | aaaaa |
telomere length | aaaaa | aaaaa |
Telomere Length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap