Systematic evaluation of sequence and activity relationships using site evaluation libraries for engineering multiple properties

a site evaluation and sequence-activity relationship technology, applied in the field of protein engineering, can solve the problems of laborious and time-consuming most methods

Inactive Publication Date: 2008-01-03
DANISCO US INC
View PDF15 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0007] The present invention provides methods for protein engineering. Specifically, the invention provides methods utilizing site evaluation libraries. In particular, the present invention provides means to use information obtained about a number of desired properties, in order to rationally and efficiently design libraries that will optimize those properties. In some embodiments, the present invention provides means to design libraries that are improved for at least two desired properties.

Problems solved by technology

Thus, most methods are laborious and time-consuming.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Systematic evaluation of sequence and activity relationships using site evaluation libraries for engineering multiple properties
  • Systematic evaluation of sequence and activity relationships using site evaluation libraries for engineering multiple properties
  • Systematic evaluation of sequence and activity relationships using site evaluation libraries for engineering multiple properties

Examples

Experimental program
Comparison scheme
Effect test

example 1

Assays

[0149] In the following Examples, various assays were used, such as protein determinations, application-based tests, and stability-based tests. For ease in reading, the following assays are set forth below and referred to in the respective Examples. Any deviations from the protocols provided below in any of the experiments performed during the development of the present invention are indicated in the Examples.

A. TCA Assay for Protein Content Determination in 96-Well Microtiter Plates

[0150] This assay was started using filtered culture supernatant from microtiter plates grown 4 days at 33° C. with shaking at 230 RPM and humidified aeration. A fresh 96-well flat bottom plate was used for the assay. First, 100 μl / well of 0.25 N HCl were placed in the wells. Then, 50 μL filtered culture broth were added to the wells. The light scattering / absorbance at 405 nm (use 5 sec mixing mode in the plate reader) was then determined, in order to provide the “blank” reading.

[0151] For the...

example 2

Production of 69B4 Protease From the Gram-Positive Alkaliphilic Bacterium 69B4

[0189] This Example provides a description of the Cellulomonas strain 69B4 used to initially isolate the novel protease 69B4 provided by the present invention. The alkaliphilic micro-organism Cellulomonas strain 69B.4, (DSM 16035) was isolated at 37° C. on an alkaline casein medium containing (g L−1) (See e.g., Duckworth et al., FEMS Microbiol. Ecol., 19:181-191 [1996]).

Glucose (Merck 1.08342)10Peptone (Difco 0118)5Yeast extract (Difco 0127)5K2HPO41MgSO4•7H2O0.2NaCl40Na2CO310Casein20Agar20

[0190] An additional alkaline cultivation medium (Grant Alkaliphile Medium) was also used to cultivate Cellulomonas strain 69B.4, as provided below:

Grant Alkaliphile Medium (“GAM”) solution A(g L−1)Glucose (Merck 1.08342)10Peptone (Difco 0118)5Yeast extract (Difco 0127)5K2HPO41MgSO4•7H2O0.2

[0191] Dissolved in 800 ml distilled water and sterilized by autoclaving

GAM solution B(g L1)NaCl40Na2CO310

[0192] Dissolved in 2...

example 3

ASP Protease Production in B. subtilis

[0197] Experiments conducted to produce 69B4 protease (also referred to herein as “ASP,”“Asp,” and “ASP protease,” and “Asp protease”) in B. subtilis are described in U.S. patent application Ser. No. 10 / 576,331, incorporated herein by reference in its entirety.

[0198] The DNA sequence (synthetic ASP DNA sequence) is provided below, with codon usage adapted for Bacillus species, encodes the wild type ASP precursor protein:

(SEQ ID NO: 1)ATGACACCACGAACTGTCACAAGAGCTCTGGCTGTGGCAACAGCAGCTGCTACACTCTTGGCTGGGGGTATGGCAGCACAAGCTAACGAACCGGCTCCTC

[0199] In the above sequence, bold indicates the DNA that encodes the mature protease, standard font indicates the leader sequence, and the underline indicates the N-terminal and C-terminal prosequences.

Expression of the Synthetic ASP Gene

[0200] Expression of the synthetic ASP gene is described in U.S. patent application Ser. No. 10 / 576,331, which is incorporated herein by reference, in its entirety.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
total volumeaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

The present invention provides methods for protein engineering. Specifically, the invention provides methods utilizing site evaluation libraries to design libraries that optimize two or more properties of a protein.

Description

[0001] The present application claims priority to pending U.S. Provisional Patent Application Ser. No. 60 / 816,202, filed Jun. 23, 2006, and pending U.S. Provisional Patent Application Ser. No. 60 / 933,312, filed Jun. 6, 2007.FIELD OF THE INVENTION [0002] The present invention provides methods for protein engineering. Specifically, the invention provides methods utilizing site evaluation libraries. BACKGROUND OF THE INVENTION [0003] Various protein engineering methods are known to those in the art. In general, proteins are modified in order to obtain desired protein properties. In most methods, the nucleotide sequence of a cloned gene encoding a protein is mutated and the modified gene is expressed to produce mutants, which are screened for activities of interest. Often, the mutant properties are compared with the properties of wild-type protein. [0004] Historically, the protein design process has been approached as equivalent to the problem of finding in all of protein space the one ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C40B30/04C12P21/00C40B30/08G01N33/00C40B30/00
CPCC12Q1/37C12N15/1086C12N15/10C12N15/52G01N33/68
InventorESTELL, DAVID A.WOLFGANG, AEHLE
OwnerDANISCO US INC