Methods for detection and quantification of analytes in complex mixtures

a technology of complex mixtures and analytes, applied in the field ofgenomics, can solve the problems of insufficient supply of biological samples, method still requires significant amounts of biological samples, and the kinetics of hybridization on the surface of a microarray are less efficient than hybridization

Inactive Publication Date: 2009-09-03
INSTITUTE FOR SYSTEMS BIOLOGY
View PDF2 Cites 58 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This approach enables accurate and sensitive detection, identification, and quantification of analytes in complex mixtures, allowing for direct counting of molecular species and improved sensitivity by operating within a narrow dynamic range, thus overcoming the limitations of existing microarray methods.

Problems solved by technology

Unfortunately, despite the miniaturization of array formats, this method still requires significant amounts of the biological sample.
However, in several cases, such as biopsies of diseased tissues or samples of a discrete cell type, the biological sample is in limited supply.
In addition, the kinetics of hybridization on the surface of a microarray is less efficient than hybridization in small amounts of aqueous solution.
This results in decreased sensitivity since there is a trade-off between sensitivity and dynamic range.
A further problem with microarray methods is that the output is quantitative analog data that has undergone several intermediary transformations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for detection and quantification of analytes in complex mixtures
  • Methods for detection and quantification of analytes in complex mixtures

Examples

Experimental program
Comparison scheme
Effect test

example i

Generation of Unique Labels Using Two Different Labels

[0115]In this example, ten unique labels are made from two different fluorescent labels. First, ten unique templates of a 220-base pair single-stranded DNA are synthesized. The templates consist of a pre-determined ratio of the following 20-base pair repeats:

5′ (ACTCTCTCTCTCTCTCTCTC)n(GCTCTCTCTCTCTCTCTCTC)m3′

where n=1, 2, 3, 4, 5, 6, 7, 8, 9, 10, m=1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and n+m=11.

[0116]The second strand is synthesized using the primer GAGAGAGAGA, Klenow polymerase, DNA ligase, dGTP, dATP, dUTP-fluorescein and dCTP-rhodamine. After the reaction is complete the product is treated with S1 nuclease to digest the DNA with gaps, and the remaining full length DNA is then purified. The labeled nucleotides will be incorporated into the DNA in a unique ratio determined by the ratio of the two repeats. The end result is ten uniquely labeled nucleic acids where the set ratio of fluorescein to rhodamine is 1:10, 2:9, 3:8, 4:7, 5:6, ...

example ii

Generation of a Labeled Specifier

[0118]The specifiers are synthesized by ligating together one target specific sequence (synthetic oligonucleotide, peptide-nucleic acid (PNA), PCR product, or linked-nucleic acid (LNA)), and several “genedigits” (see FIG. 1A). In this example, each specifier contains a unique combination of 4 different genedigits. This results in the generation of 10,000 possible unique specifiers.

[0119]The genedigits are synthetic oligonucleotides that contain only two of the natural bases, plus two bases that not found in nature: isocytidine and isoguanine. Such base composition ensures that the genedigits will not non-specifically hybridize with analytes in a complex mixture. The sequence of each genedigit is composed of 5 repeats of an 8-base pair core sequence (see FIG. 1B). Each core sequence unit differs from the others by at least two bases.

[0120]In order to make 10,000 unique specifiers, forty different genedigits are synthesized and split into 4 groups cont...

example iii

Gene Expression Analysis Using Specifiers

[0123]In order to determine differences in gene expression between astrocytes and LPS-activated astrocytes, RNA is isolated from both populations of astrocytes using cell lysis in guanidine isothiocynine or phenol / chloroform. A population of specifiers is added to each RNA sample under conditions suitable for hybridization. The mRNA-specifier complexes are isolated with oligo dT beads and washed extensively to remove excess specifiers. The specifiers are eluted from the mRNA by digesting the mRNA with RNAse A. The specifiers are then are processed for labeling as described in Examples I and II and these labels are detected using a CCD camera. The number of specifiers corresponding to specific mRNAs from un-treated astrocytes is then compared to the specifier pattern from LPS-treated astrocytes. Since the sequence of the target specific region of the specifier is known, this identifies the genes that are differentially expressed between the tw...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a diverse population of uniquely labeled probes, containing about thirty or more target specific nucleic acid probes each attached to a unique label bound to a nucleic acid. Also provided is a method of producing a population of uniquely labeled nucleic acid probes. The method consists of (a) synthesizing a population of target specific nucleic acid probes each having a different specifier; (b) synthesizing a corresponding population of anti-genedigits each having a unique label, the population having a diversity sufficient to uniquely hybridize to genedigits within the specifiers, and (c) hybridizing the populations of target nucleic acid probes to the anti-genedigits, to produce a population in which each of the target specific probes is uniquely labeled. Also provided is a method of detecting a nucleic acid analyte. The method consists of (a) contacting a mixture of nucleic acid analytes under conditions sufficient for hybridization with a plurality of target specific nucleic acid probes each having a different specifier; (b) contacting the mixture under conditions sufficient for hybridization with a corresponding plurality of anti-genedigits each having a unique label, the plurality of anti-genedigits having a diversity sufficient to uniquely hybridize to genedigits within the specifiers, and (c) uniquely detecting a hybridized complex between one or more analytes in the mixture, a target specific probe, and an anti-genedigit.

Description

BACKGROUND OF THE INVENTION[0001]This invention relates generally to the field of genomics and, more specifically to detection, identification, and quantification of target analytes in mixtures.[0002]Although all cells in the human body contain the same genetic material, the same genes are not active in all of those cells. Alterations in gene expression patterns can have profound effects on biological functions. These variations in gene expression are at the core of altered physiologic and pathologic processes. Therefore, identifying and quantifying the expression of genes in normal cells compared to diseased cells can aid the discovery of new drug and diagnostic targets.[0003]Nucleic acids can be detected and quantified based on their specific polynucleotide sequences. The basic principle underlying existing methods of detection and quantification is the hybridization of a labeled complementary probe sequence to a target sequence of interest in a sample. The formation of a duplex i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68G01N33/53C12N15/09G01N21/78G01N33/533G01N33/566G01N33/58
CPCC12Q1/6816C12Q1/6888C12Q1/682C12Q1/6876C12Q2565/102C12Q2537/143C12Q2525/161C12Q2565/1025C12Q2563/179C12Q2525/151C12Q2525/101
InventorDIMITROV, KRASSEN
OwnerINSTITUTE FOR SYSTEMS BIOLOGY