Method of detecting nucleic acid amplification reaction

a nucleic acid and amplification technology, applied in the field of nucleic acid amplification reaction detection methods, can solve the problems of complex detection process, difficult accurate measurement, poor oxidation resistance of nucleic acid, etc., and achieve the effect of simple structure, accurate measurement and simple measuremen

Inactive Publication Date: 2010-04-22
KK TOSHIBA
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0009]An object of the present invention is to provide an electrochemical detection method capable of solving these problems, that is, a constitutive and accurate detection method which requires neither addition of a reagent possibly influencing the amplification reaction nor a special sensor electrode having a complicated structure and which is not influenced by a sequence of a sample nucleic acid.
[0012]In the method of detecting a nucleic acid amplification reaction according to the present invention, a reduction current produced by the reduction reaction of a reducing agent molecule with a redox molecule, both of which are present in an amplification buffer, is measured and the voltage applied to a sample is relatively low, so that there does not occur the decomposition, with an oxidation current, of a nucleic acid poor in oxidation resistance, and accurate measurement can be realized. The method does not need addition, for detection of a reaction, of a reagent adversely affecting an amplification reaction itself and can thus realize simple measurement not adversely affecting the amplification reaction itself. Further, the method has detection accuracy not depending on the sequence of an amplification product. Furthermore, the method does not need application of a high voltage in the direction of oxidation, is thus not subject to limitation of the type of electrode used and can employ the most reliable gold electrode for example. The method deals with a reaction in solution and so needs neither expansion of the area of an electrode nor a special sensor electrode in the form of a net or disk, and can thus be carried out with an apparatus of simple structure to reduce the detection cost.

Problems solved by technology

However, a nucleic acid is poor in oxidation resistance, so the nucleic acid in a sample solution may be decomposed by oxidation to make accurate measurement difficult.
In the method described in JP-A 2007-37483 supra, there is necessity for addition of a new reagent containing a metal ion, thus making a detection process complicated, and such metal ion may reduce a polymerase activity, to adversely affect the amplification reaction.
In the method described in JP-A 2008-157733 supra, there is a problem that because a current to be detected varies significantly depending on the guanine content of a sample nucleic acid, the accuracy of detection is destabilized depending on a sequence of an amplification product, and because there is necessity for application of high voltage in the direction of oxidation, a highly reliable gold electrode with stable performance cannot be used.
For improving sensitivity, this sensor electrode is required to be molded in the form of a net or disk in order to increase the area of the electrode as a whole, thus being subject to a problem of a complicated structure of a device to increase the detection cost.
In addition, troublesome coating of the electrode with a pyrophosphate detecting substance is necessary.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of detecting nucleic acid amplification reaction
  • Method of detecting nucleic acid amplification reaction
  • Method of detecting nucleic acid amplification reaction

Examples

Experimental program
Comparison scheme
Effect test

first embodiment

(1) Preparation of Nucleic Acid Amplification Buffer

[0025]First, a nucleic acid amplification buffer is prepared. This buffer is an amplification buffer which contains not only a polymerase, a primer and an NTP substrate, but also a reducing agent molecule, a redox substance, and a magnesium ion. The former 3 substances are substances for amplifying a nucleic acid, and the latter 3 substances are substances for stabilizing a nucleic acid during amplification reaction. In addition, arbitrary components are contained appropriately in the buffer.

[0026]The amplification reaction in the first embodiment is not limited as long as it is an amplification reaction using a polymerase and NTP substrate, and this amplification reaction is selected for example from the group consisting of PCR, LAMP, ICAN and SMAP. Accordingly, the buffer contains a polymerase adapted to the amplification reaction to be carried out. For example, when the amplification reaction is conducted by PCR, a thermostable ...

example 1

1. Materials Used, Etc.

[0064](1) Nucleic Acid Amplification Buffer

[0065]In the nucleic acid amplification buffer, a primer set for model gene A amplification shown below, an enzyme for LAMP amplification, and a buffer were used. As a template, sample nucleic acid V of unknown sequence was used.

[0066]Model Gene A: Mouse 2C39

[0067]Primer Set for Model Gene A Amplification

TCAAAACGATCCTGGAAAATAATGGACATTCATTCTGAGCTGTGCGGAAAAACTAAATGAGAATGTCAAGCAGAAAAAACATTCTTGACTTCTTCACGCTCACCTTGTGACTGTGGCAATAAAGCACCAGCAGATGACATTGCATGGA

[0068](2) Electrodes

[0069]A working electrode, a counter electrode and a reference electrode used as electrochemical measurement electrodes were gold electrodes.

2. Experimental Procedures

[0070]First, an amplification reaction solution was prepared. The primer set for model gene A amplification, the enzyme for LAMP amplification and the buffer were mixed, and the sample nucleic acid V was added as a template.

[0071]Then, electrochemical measurement was conducted before the i...

example 2

1. Materials Used, Etc.

[0075](1) Nucleic Acid Amplification Buffer

[0076]In the nucleic acid amplification buffer, primer sets for model genes A and B amplification shown below, an enzyme for LAMP amplification, and a buffer were used. As templates, sample nucleic acids X and Y of unknown sequence were used.

[0077]Model Gene A: Mouse 2C39

[0078]Primer Set for Model Gene A Amplification

TCAAAACGATCCTGGAAAATAATGGACATTCATTCTGAGCTGTGCGGAAAAACTAAATGAGAATGTCAAGGAGAAAAAACATTCTTGACTTCTTCAGGCTCACCTTGTGACTGTGGCAATAAAGCACCAGCAGATGACATTGCATGGA

[0079]Model Gene B: Mouse 481

[0080]Primer Set for Model Gene B Amplification

ATTTGGAACATACTGCTCTCTTCTGCTGCCATCTTCCTTTTGACAAACTCAGACCTCCTTGAAAAGAACACAAAATCCTCGATAACTCGGATCTGGGAAGGATCAGCCTGTCTGAAGATAGCTATTCACA

[0081](2) Electrodes

[0082]A working electrode, a counter electrode and a reference electrode used as electrochemical measurement electrodes were gold electrodes.

2. Experimental Procedures

[0083]First, amplification reaction solutions were prepared. In amplifi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

The present invention provides a method of detecting a nucleic acid amplification reaction, including the steps of adding a sample nucleic acid to a nucleic acid amplification buffer containing a reducing agent molecule, a redox molecule and a magnesium ion, to conduct an amplification reaction, measuring a reduction current produced by a reduction reaction of the reducing agent molecule with the redox molecule, under the conditions that when the amplification reaction of the sample nucleic acid has proceeded in the buffer, pyrophosphoric acid formed with the progress of amplification of the sample nucleic acid forms magnesium pyrophosphate with the magnesium ion, thereby decreasing a magnesium ion concentration of the buffer, and determining, from the magnitude of the reduction current measured above, whether the sample nucleic acid has been amplified or not.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application is based upon and claims the benefit of priority from prior Japanese Patent Application No. 2008-271228, filed Oct. 21, 2008, the entire contents of which are incorporated herein by reference.BACKGROUND OF THE INVENTION[0002]1. Field of the Invention[0003]The present invention relates to a method of detecting a nucleic acid amplification reaction and in particular to a method of detecting, by an electrochemical technique, the presence or absence of nucleic acid amplification in the amplification reaction of a nucleic acid by an enzymatic reaction.[0004]2. Description of the Related Art[0005]With the development of molecular biology in recent years, many disease genes have been identified, and the identification of diseases by genetic diagnosis has become possible. Tailor-made medicine which, on the basis of results on genetic diagnosis, provides optimum treatment to each patient is being realized. Techniques of detecting ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12Q1/68
CPCC12Q1/682C12Q1/6825C12Q2565/607C12Q2565/301C12Q2563/113
InventorOKADA, JUNGEMMA, NOBUHIRO
OwnerKK TOSHIBA