Supercharge Your Innovation With Domain-Expert AI Agents!

Human Potassium Channel Genes

a potassium channel and human technology, applied in the field of human potassium channel genes, can solve problems such as reducing clinical efficacy

Inactive Publication Date: 2010-10-28
ICAGEN INC
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

Enables the development of specific compounds to modulate potassium channel activity, improving therapeutic efficacy by characterizing novel potassium channels and reducing non-specific responses.

Problems solved by technology

A difficulty encountered in therapeutic use of therapeutic agents that modify K+ channel activity is that the presently available compounds tend to be non-specific and elicit both positive and negative responses, thereby reducing clinical efficacy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human Potassium Channel Genes

Examples

Experimental program
Comparison scheme
Effect test

example 2

Chromosomal Localization

[0093]Two primers were designed in the 3′-untranslated regions of each gene sequence to amplify a product across the Stanford G3 radiation hybrid map, or the Whitehead GB4 panel. The PCR data were submitted for automatic two-point analysis. Mapping data were correlated with cytoband information and comparisons with the OMIM human gene map data base were made. The following primers were made:

K + Hnov1 on GB4(SEQ ID NO: 31) F:5′ TATCCACATCAATGGACAAAGC 3′(SEQ ID NO: 32) R:5′ TGCATAACTGGCTGGGTGTA 3′Results: 1.71 cR from D2S331, Cytogeneticlocation of 2q37K + Hnov2 on G3F: 5′ GTCAGGTGACCGAGTTCA 3′R: 5′ GCTCCATCTCCAGATTCTTC 3′Results: 0.0 cR from SHGC-1320, Cytogeneticlocation of 11q12K + Hnov6 on GB4(SEQ ID NO: 33) F:5′ TGACATCACTGGATGAACTTGA 3′(SEQ ID NO: 34) R:5′ TGCCTGCAAAGTTTGAACAT 3′Results: 5.23 cR from WI-5509, Cytogeneticlocation of 2p23K + Hnov9 on GB4(SEQ ID NO: 35) F:5′ TGACATCACTGGATGAACTTGA 3′(SEQ ID NO: 36) R:5′ TGCCTGCAAAGTTTGAACAT 3′Results 1.21 cR...

example 3

Expression Analysis

[0094]RT-PCR was utilized to characterize the expression pattern of the novel ion channels. This approach used RNA from 30 different tissues to generate first strand cDNA. Total RNA was purchased (Clontech, Invitrogen) and used to synthesize first strand cDNA using M-MLV reverse transcriptase and the supplied buffer (Gibco-BRL). The 20 μl reaction contained 5 μg total RNA, 100 ng of random primers, 10 mM DTT, 0 5 mM each dNTP, and an RNAse inhibitor (Gibco-BRL). Identical reactions were set up without reverse transcriptase to control for DNA contamination in the RNA samples. The synthesis reaction proceeded for 1 hour at 37° C. followed by 10 minutes at 95° C. These cDNAs, along with control cDNA synthesis reactions without reverse transcriptase, were diluted 1:5 and 2 μl of each sample were arrayed into 96-well trays, dried, and resuspended in PCR buffer prior to PCR amplification. The cDNAs were tested with primers with defined expression patterns to verify the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
nucleic acidaaaaaaaaaa
Login to View More

Abstract

Methods for isolating K+Hnov genes are provided. The K+Hnov nucleic acid compositions find use in identifying homologous or related proteins and the DNA sequences encoding such proteins; in producing compositions that modulate the expression or function of the protein; and in studying associated physiological pathways. In addition, modulation of the gene activity in vivo is used for prophylactic and therapeutic purposes, such as identification of cell type based on expression, and the like.

Description

INTRODUCTIONBackground[0001]Ion channels are multi-subunit, membrane bound proteins critical for maintenance of cellular homeostasis in nearly all cell types. Channels are involved in a myriad of processes including modulation of action potentials, regulation of cardiac myocyte excitability, heart rate, vascular tone, neuronal signaling, activation and proliferation of T-cells, and insulin secretion from pancreatic islet cells. In humans, ion channels comprise extended gene families with hundreds, or perhaps thousands, of both closely related and highly divergent family members. The majority of known channels regulate the passage of sodium (Na+), chloride (Cl+), calcium (Ca++) and potassium (K+) ions across the cellular membrane.[0002]Given their importance in maintaining normal cellular physiology, it is not surprising that ion channels have been shown to play a role in heritable human disease. Indeed, ion channel defects are involved in predisposition to epilepsy, cardiac arrhythm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N5/07C12N15/12C12N15/63C07K14/705
CPCC07K14/705A01K2217/05
Inventor MILLER, ANDREW P.HU, PINGCURRAN, MARK EDWARDRUTTER, MARCWANG, JIAN-YING
Owner ICAGEN INC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com