Peptides comprising an isodgr motif
Deamidated peptides targeting the DGR motif in extracellular matrix proteins, when conjugated with cytokines, provide a novel approach to selectively inhibit αvβ3 integrin and endothelial cell adhesion, addressing the limitations of existing therapies by enhancing anti-tumor activity and reducing toxicity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Examples
example 1
Materials and Methods for Examples 1 to 7
Cell Lines and Reagents
[0238]Mouse RMA lymphoma cells and EA.hy926 cells (human endothelial cells fused with human lung carcinoma A549 cells) were cultured as described previously (Curnis et al., 2005; Ljunggren and Kane, 1985). Crystal violet (Fluka Chemie); bovine serum albumin (BSA), goat anti-rabbit IgG horseradish peroxidase conjugate, FN-70 KDa, FN-45 KDa and FN-30 KDa fragments (Sigma); RetroNectin (Takara Biomedicals). Human αvβ3, αvβ5, α5β1 and α1β1 integrins (Immunological Sciences); streptavidin-peroxidase (Società Prodotti Antibiotici).
Preparation and Characterization of Recombinant FN-4-5 and FN-I4-5SGS
[0239]The cDNA coding for human fibronectin 4-5th type I repeats (FN-I4-5; residue 184-273 of fibronectin) was prepared by RT-PCR on MSR-3-mel cells total RNA (Tanzarella et al., 1999) using the following primers: 5′-CTGGATCCGAGAAGTGTTTTGATCATGCTGCTGGG (SEQ ID NO: 37) (forward) and 5′ TATATTAAGCTTTCAGTGCCTCTCACACTTCC (SEQ ID NO: 38...
example 2
Accelerated Aging of Fibronectin Fragments Generates NGR-Dependent Adhesion Stes
Accelerated Aging of Fibronectin Fragments Generates NGR-Dependent Adhesion Sites
[0253]The adhesion of EA.hy926 cells to natural, recombinant and synthetic fibronectin fragments containing the NGR motif was studied. First, the following proteolytic fragments of fibronectin were studied: a) FN-70 KDa, containing the FN-I1-9 and FN-II1-2 repeats; b) FN-30 KDa, containing the FN-I1-5 repeats; c) FN-45 KDa, containing the FN-I6-9 and FN-II1-2 (see FIG. 1 for a schematic representation). All fragments, after adsorption to microtiterplates, induced cell adhesion and spreading (FIG. 2), suggesting the presence of pro-adhesive sites in these regions.
[0254]To investigate the role of the NGR motif in the FN-I5 repeat, we then analyzed the pro-adhesive properties of FN-I5, FN-I4-5 and FN-I4-5SGS fragments, the latter corresponding to a mutant with SGS in place of NGR (residues 263-265). Recombinant FN-I4-5, but not...
example 3
Deamidation of the NGR is Associated with Increased Cell Adhesion
[0257]It is well known that the Asn residues, particularly when followed by Gly, can undergo non-enzymatic deamidation at physiological pH (Robinson and Robinson, 2001; Robinson et al., 2004; Stephenson and Clarke, 1989; Tyler-Cross and Schirch, 1991). This reaction leads to formation of Asp or isoAsp, L-Asp (LD), L-isoAsp, (LisoD), D-Asp (DD), and D-isoAsp (DisoD), although the L-configuration predominates (Geiger and Clarke, 1987). Accordingly we found that the molecular mass of FN-I5, CNGRC (SEQ ID NO: 6)-TNF and CNGRC (SEQ ID NO: 6) peptides was increased by about 1 Da, by mass spectrometry analysis, after heat treatment. Furthermore, isoAsp analysis of CNGRC (SEQ ID NO: 6)-TNF showed the presence of >0.5 pmol isoAsp / mol of CNGRC (SEQ ID NO: 6)-TNF subunit after heat treatment.
[0258]To assess whether the enhanced adhesive properties of FN-I5 after heat-treatment depended on NGR deamidation, we incubated the “heat t...
PUM
| Property | Measurement | Unit |
|---|---|---|
| wt % | aaaaa | aaaaa |
| temperatures | aaaaa | aaaaa |
| mass | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 