Supercharge Your Innovation With Domain-Expert AI Agents!

Locked nucleic acid inhibitor mir-145 and uses thereof

a technology of locked nucleic acid and inhibitor, which is applied in the field of oligonucleotides, can solve the problems of antisense-based therapeutic targeting and loss of activity, and achieve the effects of improving the potency, stability, potency, specificity and/or toxicity profile, and improving the efficiency of delivery

Inactive Publication Date: 2016-01-14
MIRAGEN THERAPEUTICS
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention is about a new treatment for diseases associated with miR-145 expression or activity, such as diseases associated with smooth muscle tissue. The invention is based on the discovery that an oligonucleotide targeting miR-145 with a specific chemical pattern or motif has increased potency, efficiency, and target specificity when administered to a subject. Additionally, the oligonucleotide has increased lung efficacy as compared to a second oligonucleotide with different chemical patterns and motifs.

Problems solved by technology

However, delivery of an antisense-based therapeutic targeting miR-145 can pose several challenges.
For example, when oligonucleotides are introduced into intact cells they are typically attacked and degraded by nucleases leading to a loss of activity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Locked nucleic acid inhibitor mir-145 and uses thereof
  • Locked nucleic acid inhibitor mir-145 and uses thereof
  • Locked nucleic acid inhibitor mir-145 and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

In Viva Efficacy of AntimiR-145 Compounds

[0109]To optimize the compound targeting miR-145 in the lung, an in vivo screen was performed using de-repression of direct mRNA targets of miR-145 in the lung, as a read-out for in vivo functionality.

[0110]In total 9 different antimiR designs were tested in rat, as depicted in Table 1:

TABLE 1Inhibitor designs.SEQSeed RegionID NO:miR-145uccctaaggacccuuuugaccug10(3′ to 5′)miR-145agggattcctgggaaaactggac11ReverseComplement(5′ to 3′)M#Position #1234567891011121314151610934TcctGGgAaAAcTgGA1211239TcCTGGgAaAacTggA1311241TcCtGgGaAaAcTgGA1411242TccTGgGaAAaCtGgA1511244TcCTggGAaAaCtGgA1611318TcctGGgaAAAcTgGA1711319TCctgGgAaAAcTgGA1811320TCctgGGaaAACtGgA1911321TcctGGgAaAAcTGgA20

TABLE 2Description of Notationsdeoxy Aadeoxy Ggdeoxy Ccdeoxy Ttlna AAlnaGGlna CClna TT

[0111]The nine antimiR compounds in Table 1 were assayed for target derepression in the Sprague-Dawley rats. Sprague-Dawley rats of 49 to 52 days of age were injected subcutaneously at a dose of ...

example 2

MiR-145 Specificity of AntimiR-145 Compound

[0114]Sprague-Dawley rats of 49 to 52 days of age were injected subcutaneously with saline or M-11318 at a dose of 25 mg / kg. Total RNA from the lungs of M-11318-treated rats and saline-treated rats were subjected to whole genome profiling with microarray profiling. MiR-145 seed-containing genes are enriched in the upregulated gene signature (p-value <0.01 for differential expression) when total RNA from the lungs of M-11318-treated rats is compared to total RNA from the lungs of saline-treated rats. The p-value for enrichment was calculated using a hypergeometric distribution function (FIG. 3). These results indicate that M-11318 elicits gene target derepression that is specific to miR-145.

example 3

Dose-Dependent Target Derepression by AntimiR-145 Compound M-11318

[0115]Sprague-Dawley rats of 49 to 52 days of age were injected subcutaneously with saline at a dose of 25 mg / kg, M-10591 at a dose of 25 mg / kg, M-10934 at a dose of 25 mg / kg, or M-11318 at a dose of 5 mg / kg, 10 mg / kg, or 25 mg / kg. Lung tissue was collected 72 hours after injection. The mRNA of Klf5 in total lung RNA was measured by real time PCR. The results are shown in FIG. 4 as fold-change values relative to saline-treated animals. The real time PCR results indicates that KLF5 target derepression is dose-responsive to M-11318 treatment.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Dimensionless propertyaaaaaaaaaa
Compositionaaaaaaaaaa
Lengthaaaaaaaaaa
Login to View More

Abstract

The present invention provides oligonucleotides with chemical motifs that are miR-145 inhibitors. The oligonucleotides can be used for the treatment and prevention of a condition by inhibiting the expression or activity of miR-145 in cells of a subject in need thereof. Methods provided include treating or preventing pulmonary arterial hypertension, neointima formation, restenosis or hypertension in a subject in need thereof by administering to the subject an inhibitor of miR-145 expression or activity. Pharmaceutical compositions and kits comprising miR-145 inhibitors are also disclosed.

Description

CROSS-REFERENCE[0001]This application claims the benefit of U.S. provisional Application No. 61 / 800,755, filed on Mar. 15, 2013, which is herein incorporated by reference in its entirety.DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY[0002]The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: MIRG—41—01 WO_SeqList_ST25.txt, date recorded: Mar. 13, 2014, file size 5 kilobytes).FIELD OF THE INVENTION[0003]The present invention relates generally to oligonucleotides with chemical motifs that are miR-145 inhibitors. The oligonucleotides of the present invention can have advantages in potency, efficiency of delivery, target specificity, stability, and / or toxicity when administered to a subject. The oligonucleotides can be used for the treatment and prevention of a condition by inhibiting the expression or activity of miR-145 in cells of a subject in ne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113
CPCC12N15/113C12N2310/3231C12N2310/315C12N2310/322C12N2310/113C12N2310/321A61K31/713A61P9/12A61P11/00A61P43/00C07H21/00
Inventor SETO, ANITA G.VAN ROOIJ, EVAROBINSON, KATHRYN H.DALBY, CHRISTINA M.HULLINGER, THOMAS G.MONTGOMERY, RUSTY
Owner MIRAGEN THERAPEUTICS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More