Locked nucleic acid inhibitor mir-145 and uses thereof
a technology of locked nucleic acid and inhibitor, which is applied in the field of oligonucleotides, can solve the problems of antisense-based therapeutic targeting and loss of activity, and achieve the effects of improving the potency, stability, potency, specificity and/or toxicity profile, and improving the efficiency of delivery
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
In Viva Efficacy of AntimiR-145 Compounds
[0109]To optimize the compound targeting miR-145 in the lung, an in vivo screen was performed using de-repression of direct mRNA targets of miR-145 in the lung, as a read-out for in vivo functionality.
[0110]In total 9 different antimiR designs were tested in rat, as depicted in Table 1:
TABLE 1Inhibitor designs.SEQSeed RegionID NO:miR-145uccctaaggacccuuuugaccug10(3′ to 5′)miR-145agggattcctgggaaaactggac11ReverseComplement(5′ to 3′)M#Position #1234567891011121314151610934TcctGGgAaAAcTgGA1211239TcCTGGgAaAacTggA1311241TcCtGgGaAaAcTgGA1411242TccTGgGaAAaCtGgA1511244TcCTggGAaAaCtGgA1611318TcctGGgaAAAcTgGA1711319TCctgGgAaAAcTgGA1811320TCctgGGaaAACtGgA1911321TcctGGgAaAAcTGgA20
TABLE 2Description of Notationsdeoxy Aadeoxy Ggdeoxy Ccdeoxy Ttlna AAlnaGGlna CClna TT
[0111]The nine antimiR compounds in Table 1 were assayed for target derepression in the Sprague-Dawley rats. Sprague-Dawley rats of 49 to 52 days of age were injected subcutaneously at a dose of ...
example 2
MiR-145 Specificity of AntimiR-145 Compound
[0114]Sprague-Dawley rats of 49 to 52 days of age were injected subcutaneously with saline or M-11318 at a dose of 25 mg / kg. Total RNA from the lungs of M-11318-treated rats and saline-treated rats were subjected to whole genome profiling with microarray profiling. MiR-145 seed-containing genes are enriched in the upregulated gene signature (p-value <0.01 for differential expression) when total RNA from the lungs of M-11318-treated rats is compared to total RNA from the lungs of saline-treated rats. The p-value for enrichment was calculated using a hypergeometric distribution function (FIG. 3). These results indicate that M-11318 elicits gene target derepression that is specific to miR-145.
example 3
Dose-Dependent Target Derepression by AntimiR-145 Compound M-11318
[0115]Sprague-Dawley rats of 49 to 52 days of age were injected subcutaneously with saline at a dose of 25 mg / kg, M-10591 at a dose of 25 mg / kg, M-10934 at a dose of 25 mg / kg, or M-11318 at a dose of 5 mg / kg, 10 mg / kg, or 25 mg / kg. Lung tissue was collected 72 hours after injection. The mRNA of Klf5 in total lung RNA was measured by real time PCR. The results are shown in FIG. 4 as fold-change values relative to saline-treated animals. The real time PCR results indicates that KLF5 target derepression is dose-responsive to M-11318 treatment.
PUM
Property | Measurement | Unit |
---|---|---|
Dimensionless property | aaaaa | aaaaa |
Composition | aaaaa | aaaaa |
Length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap