Method for opening tight junctions

a tight junction and opening technology, applied in the field of tight junction opening, can solve the problems of incomplete breakdown of the blood-brain barrier, disastrous consequences for brain function, and attempts made without a comprehensive understanding of the structure of the tight junction (tj), and without transcript ablating technology

Inactive Publication Date: 2017-06-15
TRINITY COLLEGE DUBLIN
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This approach enables the reversible and size-selective opening of the BBB, facilitating the delivery of small molecules and drugs that previously could not cross, while maintaining barrier integrity post-treatment, offering a controlled and non-invasive method for drug delivery to the brain.

Problems solved by technology

However, complete breakdown of the blood-brain barrier would have disastrous consequences for brain function.
Previous attempts have been made without a comprehensive understanding of the structure of the tight junctions (TJ's), without technologies capable of ablating transcripts encoding TJ proteins and without a means of systemic delivery of such agents to the endothelial cells of brain or retinal capillaries (Miller, 2002).
However, these knockout mice had very high mortality rates and only survived for a few hours.
As such, these knockout mice cannot be used to study the physiology of the BBB and alternative models are needed.
However, despite these advances, many drugs are still ineffective because they are unable to cross the BBB.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for opening tight junctions
  • Method for opening tight junctions
  • Method for opening tight junctions

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0200]In Vivo Suppression of Claudin-5 Expression at the Blood Brain Barrier of C57 / Bl-6 Mice Using Systemic Hydrodynamic Tail Vein Delivery of siRNA Targeting Claudin-5

Materials

[0201]Web-Based siRNA Design Protocols Targeting Claudin-5

[0202]siRNAs were selected targeting conserved regions of the published cDNA sequences. To do this, cDNA sequences from mouse were aligned for the Claudin-5 gene and regions of perfect homology subjected to updated web-based protocols (Dharmacon, Ambion, Genescript) originally derived from criteria as outlined by Reynolds et al., (2004). Sequences of the claudin-5 siRNA used in this study were as follows:

Sense sequence: (SEQ ID NO. 1)CGUUGGAAAUUCUGGGUCUUUAntisense sequence: (SEQ ID NO. 2)AGACCCAGAAUUUCCAACGUU

[0203]Non-targeting control siRNA targeting human rhodopsin was used as a non-targeting control since rhodopsin is only expressed in photoreceptor cells in the retina and at low levels in the pineal gland of the brain (O'Reilly, M et al., 2007):

Se...

example 2

of Thyrotropin Releasing Hormone (TRH) Across the Blood Brain Barrier (BBB) to Claudin-5 Suppressed Mice

Materials & Method

Thyrotropin Releasing Hormone (TRH) (Sigma Aldrich, Ireland)

[0239]TRH has been proposed as having distinct neuroprotective effects. It also induces “wet dog shake” behavioural outputs when administered to rats. However, TRH has several disadvantages, including its instability and resulting short duration of action and its slow permeation across the BBB.

Delivery of TRH to Claudin-5 Suppressed Mice

[0240]The protocol of Example 1 was followed to produce transiently claudin-5 suppressed mice.

[0241]48 hours post-delivery of siRNA targeting claudin-5 or a non-targeting siRNA, a 200 μl of a solution containing 20 mg / kg Thyrotropin Releasing Hormone (TRH) was injected to the claudin-5 suppressed mice. TRH was injected in the tail vein and immediately, the behavioural output of mice was assessed by filming them in a clear Perspex box.

Results and Conclusion

[0242]As shown i...

example 3

[0245]In Vivo Suppression of Claudin-1 Expression at the Blood Brain Barrier of C57 / Bl-6 Mice Using Systemic Hydrodynamic Tail Vein Delivery of siRNA Targeting Claudin-1

Materials:

[0246]Web-Based siRNA Design Protocols Targeting Claudin-1

CLDN1 (1) target sequence: (SEQ ID NO. 32):GCAAAGCACCGGGCAGAUASense sequence:(SEQ ID NO. 9)AUAGACGGGCCACGAAACGUUAnti-sense strand:(SEQ ID NO. 10)CGUUUCGUGGCCCGUCUAUUUCLDN1 (2) target sequence:(SEQ ID NO. 33)GAACAGUACUUUGCAGGCA:Sense strand:(SEQ ID NO. 11)ACGGACGUUUCAUGACAAGUUAnti-sense strand:(SEQ ID NO. 12)CUUGUCAUGAAACGUCCGUUUCLDN1 (4) target sequence: (SEQ ID NO. 34):UUUCAGGUCUGGCGACAUUSense sequence:(SEQ ID NO. 13)UUACAGCGGUCUGGACUUUUUAnti-sense strand:(SEQ ID NO. 14)AAAGUCCAGACCGCUGUAAUU

Methods:

[0247]The protocols used were identical to the protocols used in Example 1.

Results and Conclusions:

[0248]Results are shown in FIGS. 3A, 23 and 24.

[0249]This example shows that siRNA directed against claudin-1 causes an increase in paracellular permeabilit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is directed to a method and use of RNA interference (RNAi) for the transient, reversible and controlled opening of the tight junctions of the blood brain barrier and / or the blood retinal barrier. This method may be used in the treatment of many diseases and disorders which require the opening of the blood brain barrier and / or blood retinal barrier. Such methods generally involve the use of an RNAi-inducing agent, such as siRNA, miRNA, shRNA or an RNAi-inducing vector whose presence within a cell results in production of an siRNA or shRNA, targeting tight junction proteins to open the blood brain barrier and / or blood retinal barrier.

Description

CLAIM OF PRIORITY[0001]This application claims the benefit of priority under 35 U.S.C. §120 to, and is a divisional of, U.S. patent application Ser. No. 12 / 682,331, which application is the U.S. national stage under 35 U.S.C. §371 of International Application Number PCT / EP2008 / 063734, having an international filing date of Oct. 13, 2008, which claims benefit of priority to European Patent Application Number 07118412.1, filed Oct. 12, 2007, and to Republic of Ireland Patent Application Number 2008 / 0743, filed Sep. 12, 2008, all of which applications are incorporated herein by reference.INTRODUCTION[0002]The present invention is directed to a method and use of RNA interference (RNAi), using RNAi inducing agents, such as siRNA, miRNA, shRNA or an RNAi-inducing vector whose presence within a cell results in production of an siRNA or shRNA, targeting tight junction proteins, for the transient, reversible and controlled opening of the tight junctions of the blood brain barrier and / or the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/113A61K45/06A61K31/713C12N15/11
CPCC12N15/1138A61K31/713C12N2320/31C12N2310/14A61K45/06C12N15/111C12N2320/32A61P25/28A61K38/1709A61K9/1272A61K48/0066A61K48/0083C12N15/85
InventorPETER, HUMPHRIESCAMPBELL, MATTHEWKIANG, ANNA-SOPHIA
OwnerTRINITY COLLEGE DUBLIN