Vitreoscilla hemoglobin gene and its uses
A technology of hemoglobin and Vibrio vitreous bacteria, which is applied in the directions of hemoglobin/myoglobin, application, genetic engineering, etc., to achieve the effect of increasing the expression amount, improving the utilization rate and solving the safety problem
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1. Acquisition of Hansenula polymorpha Hemoglobin Gene Hb Preferring Vitiligo hyaline:
[0024] According to GenBank No.: AY278200 Vitiligo hyaline hemoglobin gene sequence and Hansenula codon preference, optimize the Vitiligo hyaline hemoglobin gene, design the recombined Vitiligo hyaline hemoglobin gene with Hansenula polymorpha preferred codons, and then Using the method of PCR to artificially synthesize the hemoglobin gene of Hansenula polymorpha preferring Vitiligo hyaline. Primer sequences are shown in Table 1.
[0025] Table 1. Primer sequences for PCR synthesis of the Hb gene from H. polymorpha
[0026] name
Sequence (5'-3')
HF1
5′gaattcatggaccaacaaactattaacattattaaggctactgttccagttttgaaggagc 3′
HF2
5′ctattactactactttctacaagaacttgttcgctaagcacccagaggttagaccattg 3′
HF3
5′gggtagacaagagtctttggagcaaccaaaggctttggctatgactgttttggctgctg 3′
HF4
5′ ttgagaacttgccagctattttgccagctgttaagaagattgctgttaagcactgtcaa 3...
Embodiment 2
[0033] Example 2, the construction of the expression vector containing the recombinant Vitella hyaline hemoglobin gene and the acquisition of engineering bacteria
[0034] 1. Construction of FMD promoter vector and MOX promoter vector
[0035] For the construction process of pHFMDZA and pHMOXZA (pHFMDZA and pHMOXZA see literature Houhui Song, Yong Li, Weihuan Fang, Yunfeng Geng, Xu Wang, Min Wang, BingshengQiu, Development of a set of expression vectors in Hansenula polymorpha, Biotechnology Letters, Volume 25 , Issue 23, Dec 2003, Pages 1999-2006) were transformed to obtain a new FMD promoter vector pHFMDZR25SA-M and a MOX promoter vector pHMOXZR25SA-M. These two vectors contain autonomous replication sequences, HARS (sequence 2) 25SrDNA (sequence 3), these two originals can increase the copy number of the target gene. The termination sequence AOX-TT of pHFMDZA and pHMOXZA were replaced with FMD-TT sequence (SEQ ID NO: 4) and MOX-TT sequence (SEQ ID NO: 5), respectively.
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
