White-/grey transformation regulation factor gene of Candida albicans and its uses
A technology of Candida albicans and amino acids, applied in genetic engineering, plant gene improvement, application, etc., can solve the problems of white/gray transition regulators of Candida albicans that have not been reported
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0124] Acquisition and sequence analysis of CaTOS9 gene from Candida albicans
[0125] Using the principle of functional complementarity, the Candida albicans genomic DNA library constructed by conventional methods was transferred into a conventional haploid Saccharomyces cerevisiae flo8 deletion strain, and those genes that could correct the growth defects of the deletion strain on agar invasion were screened. In this screen, a clone was obtained that strongly corrected the invasive growth defect of the flo8-deficient strain. The clone was analyzed and compared by enzyme digestion map and sequence determination, and it was known from the online BLASTn and Candida albicans genome database that the clone contained a complete reading frame.
[0126] Based on the comparison results, the following primers were synthesized:
[0127] Upstream primers:
[0128] 5'ACTTTTCTTTCCTAAACATTA3' (SEQ ID NO: 3)
[0129] Downstream primers:
[0130] 5'AAGGTGAATTCGCAATGACA3' (SEQ ID NO: 4) ...
Embodiment 2
[0136] Transcription regulation of CaTOS9 gene in Candida albicans
[0137] In C. albicans diploid wild-type strains, the CaTOS9 gene was not transcribed, but it was transcribed in nrg1, tup1 and efg1 deletion strains. CaTOS9 gene transcription is regulated by mycelial growth regulators Nrg1, Tup1 and Efg1. The CaTOS9 gene has two transcripts, ~3.9kb and ~2.5kb, respectively. Nrg1 represses the expression of small transcripts of CaTOS9 at 25°C under YPD culture conditions. However, in the tup1 and efg1 deletion strains, whether at 25°C (YPD) or 37°C (YPD plus serum), the transcript levels of the two transcripts of CaTOS9 increased ( figure 2 ). The expression of CaTOS9 gene was hardly detected in the white cells of Candida albicans WO-1 bacteria, while both transcripts of CaTOS9 gene and size were expressed in the gray cells of WO-1 bacteria (opaque cells) ( image 3 C).
Embodiment 3
[0139] Knockout of the gene CaTOS9 in Candida albicans
[0140] In order to study the function and role of the CaTOS9 gene in the morphogenesis of Candida albicans, in this example, the PCR method was used to knock out the CaTOS9 gene. Knockout strategy see image 3 a.
[0141] The specific method is as follows:
[0142] Using 5' primers:
[0143] 5'GGAACCTGTTTCCAGAAAGACCCCATGAACGTGAACGAGGCGTGCTTATAGTTTCTGGAAGGTTTCCCAGTCACGACGTT3' (SEQ ID NO: 5)
[0144] and 3' primers:
[0145] 5'CGGTGTAATACGACCCAGAAGAATTTCCAACTGCGTCATCTGTTCCAGCAGCAACCAATGTGTGGAATTGTGAGCGGATA3' (SEQ ID NO: 6)
[0146] (The 60 bases at the 5' end of each primer are homologous to the CaTOS9 gene, and the 20 bases at the 3' end are paired with the DNA in the template plasmid for PCR amplification)
[0147] With conventional vectors pGEM-HIS1, pGEM-URA3 and pGEM-ARG4 (R.Bryce Wilson, DanaDavis, and Aaron P.Mitchell, Journal of Bacteriology, March 1999, p.1868-1874, Vol.181, No.6; Marcus E.Marvin, Robert P....
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More