Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes
A therapeutic drug and hypoglycemic technology, applied in the direction of medical preparations containing active ingredients, drug combinations, recombinant DNA technology, etc., can solve problems such as short half-life and limited clinical application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] The recombinant expression of the long-acting hypoglycemic peptide and its application in diabetes treatment drugs will be further described below in conjunction with the examples:
[0040] Expression of GLPAG-human albumin fusion protein in Pichia pastoris:
[0041] Acquisition of the GLPAG gene:
[0042] First synthesize the following primers (synthesized by Dalian Bao Biological Engineering Co., Ltd.):
[0043] GLP-F1: 5' tactcgagaaaagacatggtgaagggacctttaccagtg 3';
[0044] GLP-R1: 5'tccaaataagaacttacatcactggtaaaggtccc 3';
[0045] GLP-R2: 5' tccttggcagcttggccttccaaataagaacttac 3';
[0046] GLP-R3: 5'accagccaagcaatgaactccttggcagcttggcc 3';
[0047] GLP-R4: 5' tcggcctttcaccagccaagcaatg 3';
[0048] They were spliced into a complete GLPAG gene by fusion PCR method, and the sequence after splicing is as follows:
[0049] 5’tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttgga
[0050] aggccaagctgccaaggagttcattgcttggctggtgaaaggccga 3'; the 5' end of the seq...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com