Unlock instant, AI-driven research and patent intelligence for your innovation.

Streptavidin-tumour putrescence factor alpha fusion protein

A tumor necrosis factor and fusion protein technology, which is applied in the field of recombinant protein of tumor necrosis factor alpha, which can solve the problems of shock and limited clinical application.

Inactive Publication Date: 2008-03-26
SOUTHERN MEDICAL UNIVERSITY
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, when the blood concentration of tumor necrosis factor α is too high, it can cause shock, high fever and damage to the lung, heart and adrenal gland, which greatly limits its clinical application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptavidin-tumour putrescence factor alpha fusion protein
  • Streptavidin-tumour putrescence factor alpha fusion protein
  • Streptavidin-tumour putrescence factor alpha fusion protein

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0026] Example 1 Preparation of fusion protein 6His-SA-L-TNFα of the present invention

[0027] 1. Use the DNeasy tissue kit to extract bacterial genomic DNA from Streptomyces avidin, and then use it as a template to prepare mature streptavidin cDNA by PCR with Platinum pfx DNA polymerase.

[0028] Primer: 5'GGAATTCCATATGCATCATCACCATCACCATGAGGCCGGCATCACCGGC

[0029] ACCTGG 3' (55nt) and 5' GGAATTCGGCGGATCCGCCCCCGCCGCTGCCTCCGCCCCCG

[0030] CTGCCCCCGCTCGTCTGCTGAACGGCGTCGAGCGGGTTGCC 3' (82nt).

[0031] Reaction conditions: denaturation at 94°C, 2min, cycle (94°C, 15s→60°C, 15s→68°C, 30s) for 25 rounds, and finally 68°C, 5min.

[0032] 2. Extract the total RNA of PHA-activated peripheral blood mononuclear cells with Trizol, and use it as a template to prepare mature TNFα cDNA by RT-PCR.

[0033] Primers: 5'GGAATTCATGGTTCGTTCTTCTTCTCGTACTCC 3' (33nt) and 5'CCCAAGCTTTCACAGAGCGATAATACCGAAGTATAC (36nt).

[0034] Reaction conditions: denaturation at 94°C, 2min, cycle (94°C, 15s→60...

example 2

[0048] Example 2 Preparation of 6His-SA-L-TNFα-modified tumor vaccine

[0049] will be 10 7 Suspend B16.F10 cells in 1ml 1×PBS, add 0.5mg Sulfo-NHS-LC-Biotin and mix well, then act at room temperature for 30 minutes; wash the cells 3 times with 1×PBS, 6 Add 200ng of 6His-SA-L-TNFα fusion protein to each B16.F10 cell, and let it react on ice for 30 minutes; wash the cells once with 1×PBS, and then inactivate them with γ-rays (20000rad).

example 3

[0050] Example 3 Modification effect and stability detection of fusion protein of the present invention on tumor cells

[0051] The 6His-SA-L-TNFα fusion protein anchored on the surface of biotinylated B16.F10 was detected by flow cytometry with anti-TNFα monoclonal antibody and fluorescently labeled secondary antibody. The results are shown in Figure 3, almost 100 % of tumor cells were modified, and there was a large amount of TNFα on the surface of tumor cells. Analysis of the stability of the 6His-SA-L-TNFα fusion protein anchored on the surface of tumor cells by flow cytometry showed that there was no significant decrease in the number of these anchored fusion proteins on the cell surface within one week.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides one kind of fusion protein consisting of a chain avidin, a junctional peptide and a tumor necrosis factor-alpha connected together. The chain avidin is connected to the N terminal of the junctional peptide, the tumor necrosis factor-alpha in the C terminal, and the junctional peptide is SerSerGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySer. The fusion protein has the activity of both chain avidin and tumor necrosis factor-alpha, and can have its tumor necrosis factor-alpha anchored to the surface of biotinylated tumor cell by means of the powerful joint between the chain avidin and the biotin and exist stably on the surface of gamma ray deactivated tumor cell while maintaining the activity of tumor necrosis factor-alpha. The tumor vaccine surface modified with the fusion protein has the functions of preventing and treating tumor.

Description

technical field [0001] The invention relates to the fields of genetic engineering and protein engineering, in particular to the recombinant protein of tumor necrosis factor alpha. Background technique [0002] Tumor necrosis factor α (TNFα) is produced by activated monocyte-macrophages such as bacterial lipopolysaccharide, which can cause hemorrhage and necrosis of tumor tissue. It has the following functions: it can directly kill tumor cells without damaging normal cells; The activity and killing function of macrophages can enhance the ability of macrophages to promote immune response and play an anti-infective role; it can promote the activity and aggregation of neutrophils in local inflammation; it can promote T lymphocytes to produce interferon, IL-6, etc., and enhance Anti-disease ability of the body; can cooperate with IL-1, IL-2, interferon, etc. to enhance immunity. However, when the blood concentration of tumor necrosis factor α is too high, it can cause shock, hig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N1/21A61K38/16A61K39/00A61P35/00
Inventor 高基民林来新妹周明乾胡志明
Owner SOUTHERN MEDICAL UNIVERSITY