Strepavidin/sCD40L fusion protein
A fusion protein and avidin technology, applied in the fields of genetic engineering and protein engineering, can solve the problems of time-consuming preparation of autologous tumor cell vaccines, inability to provide tumor cells, and low modification efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0026] Preparation of Example 1 Fusion Protein 6His-SA-L-sCD40L
[0027] 1. Use the DNeasy tissue kit to extract bacterial genomic DNA from Streptomyces avidin, and then use it as a template to prepare mature streptavidin cDNA by PCR with Platinum pfx DNA polymerase.
[0028] Primers:
[0029] 5'GGAATTCCATATGCATCATCACCATCACCATGAGGCCGGCATCACCGGCACCTGG3' (55nt) and
[0030] 5'GGAATTCGCCGGATCCGCCCCCGCCGCTGCCTCCGCCCCCGCTGCCCCCGCTCGTCTGCTGAACGGCGTCGAGCGGGTTGCC 3' (82nt).
[0031] Reaction conditions: denaturation at 94°C, 2min, cycle (94°C, 15s→60°C, 15s→68°C, 30s) for 25 rounds, and finally 68°C, 5min.
[0032]2. Extract the total RNA of ConA-activated mouse splenocytes with Trizol, and use it as a template to prepare soluble CD40L cDNA by RT-PCR.
[0033] Primers: 5'GGAATTCATGCAAAGAGGTGATGAGGA3'(27nt) and
[0034] 5'CCTCGAGTCAGAGTTTGAGTAAGCCAA3' (27nt)
[0035] Reaction conditions: denaturation at 94°C, 2min, cycle (94°C, 15s→60°C, 15s→68°C, 30s) for 25 rounds, and finally 6...
example 2
[0048] Example 2 Modification effect and stability detection of fusion protein of the present invention on tumor cells
[0049] The 6His-SA-L-sCD40L fusion protein anchored on the surface of biotinylated MB49 cells was detected by flow cytometry with anti-CD40L antibody and fluorescently labeled secondary antibody. The results are shown in Figure 4 , almost 100% of tumor cells are modified, and there are a large number of CD40L on the surface of tumor cells. Analysis of the stability of the 6His-SA-L-sCD40L fusion protein anchored on the surface of tumor cells by flow cytometry showed that there was no significant decrease in the number of these anchored fusion proteins on the cell surface within one week.
example 3
[0050] Example 3 Fusion protein of the present invention carries out the measurement of CD40L biological activity
[0051] The in vitro activity of the fusion protein was determined by co-stimulating mouse B cells with CD40L and IL4. Prepare a C57 mouse splenocyte suspension. Mononuclear cells were separated by Ficoll liquid density gradient centrifugation, and B cells were separated by nylon wool column. Add 1×10 to each well of 96-well plate 5 B cells and 10ng / ml IL4, then add different concentrations of SA-CD40L fusion protein, and apply CD40L standard as a control, and set up three duplicate wells for each concentration. Incubate at 37°C, 5% CO2 for 72 hours. Four hours before the end of the culture, 20 μl of 5 mg / ml MTT was added to each well, and the culture was continued for 4 hours. After centrifugation, the supernatant was removed, and 100 μl of DMSO was added to each well, and the absorbance at OD570nm was measured. The results are shown in the figure, the fusion...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com