Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Strepavidin/sCD40L fusion protein

A fusion protein and avidin technology, applied in the fields of genetic engineering and protein engineering, can solve the problems of time-consuming preparation of autologous tumor cell vaccines, inability to provide tumor cells, and low modification efficiency.

Inactive Publication Date: 2011-01-05
WENZHOU MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the preparation of tumor cell vaccines by gene modification has the following inherent defects: the efficiency of modification is generally low (especially in situ gene transfection or transduction), and depends on the type of tumor cells; It is difficult to achieve the effective concentration of the protein expression product locally and maintain it for a long time, so the actual anti-tumor clinical effect is very limited; due to individual differences and the inconsistency of the survival status of tumor cells when obtaining tumor samples, some patients often fail to provide survival information. Tumor cells in good condition cannot eventually be made into autologous tumor cell vaccines; there are often potential viral vector safety issues (so-called "genotoxicity") and immunogenicity issues (repeated use of the same viral vector will affect the expression efficiency of the introduced gene ); it is difficult to efficiently express multiple synergistic immunostimulatory factors at the same time, and to precisely control their expression
In addition, the preparation of genetically modified autologous tumor cell vaccines is time-consuming, and it is not easy to carry out large-scale and widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strepavidin/sCD40L fusion protein
  • Strepavidin/sCD40L fusion protein
  • Strepavidin/sCD40L fusion protein

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0026] Preparation of Example 1 Fusion Protein 6His-SA-L-sCD40L

[0027] 1. Use the DNeasy tissue kit to extract bacterial genomic DNA from Streptomyces avidin, and then use it as a template to prepare mature streptavidin cDNA by PCR with Platinum pfx DNA polymerase.

[0028] Primers:

[0029] 5'GGAATTCCATATGCATCATCACCATCACCATGAGGCCGGCATCACCGGCACCTGG3' (55nt) and

[0030] 5'GGAATTCGCCGGATCCGCCCCCGCCGCTGCCTCCGCCCCCGCTGCCCCCGCTCGTCTGCTGAACGGCGTCGAGCGGGTTGCC 3' (82nt).

[0031] Reaction conditions: denaturation at 94°C, 2min, cycle (94°C, 15s→60°C, 15s→68°C, 30s) for 25 rounds, and finally 68°C, 5min.

[0032]2. Extract the total RNA of ConA-activated mouse splenocytes with Trizol, and use it as a template to prepare soluble CD40L cDNA by RT-PCR.

[0033] Primers: 5'GGAATTCATGCAAAGAGGTGATGAGGA3'(27nt) and

[0034] 5'CCTCGAGTCAGAGTTTGAGTAAGCCAA3' (27nt)

[0035] Reaction conditions: denaturation at 94°C, 2min, cycle (94°C, 15s→60°C, 15s→68°C, 30s) for 25 rounds, and finally 6...

example 2

[0048] Example 2 Modification effect and stability detection of fusion protein of the present invention on tumor cells

[0049] The 6His-SA-L-sCD40L fusion protein anchored on the surface of biotinylated MB49 cells was detected by flow cytometry with anti-CD40L antibody and fluorescently labeled secondary antibody. The results are shown in Figure 4 , almost 100% of tumor cells are modified, and there are a large number of CD40L on the surface of tumor cells. Analysis of the stability of the 6His-SA-L-sCD40L fusion protein anchored on the surface of tumor cells by flow cytometry showed that there was no significant decrease in the number of these anchored fusion proteins on the cell surface within one week.

example 3

[0050] Example 3 Fusion protein of the present invention carries out the measurement of CD40L biological activity

[0051] The in vitro activity of the fusion protein was determined by co-stimulating mouse B cells with CD40L and IL4. Prepare a C57 mouse splenocyte suspension. Mononuclear cells were separated by Ficoll liquid density gradient centrifugation, and B cells were separated by nylon wool column. Add 1×10 to each well of 96-well plate 5 B cells and 10ng / ml IL4, then add different concentrations of SA-CD40L fusion protein, and apply CD40L standard as a control, and set up three duplicate wells for each concentration. Incubate at 37°C, 5% CO2 for 72 hours. Four hours before the end of the culture, 20 μl of 5 mg / ml MTT was added to each well, and the culture was continued for 4 hours. After centrifugation, the supernatant was removed, and 100 μl of DMSO was added to each well, and the absorbance at OD570nm was measured. The results are shown in the figure, the fusion...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fusion protein. The fusion protein is composed of strepavidin and soluble CD40L which are bonded by a joint peptide, wherein the amino acid sequence of the joint peptide is Thr Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Glu Phe. The fusion protein has the combined activities of both the strepavidin and the CD40L; the CD40L can be anchored on the surface of biotinylated tumor cell through the strong bonding between the strepavidin and biotin and exist stably on the surface of the tumor cell inactivated by gamma rays while retaining the activity of the CD40L. The fusion protein has a function of treating tumor by locally anchoring tumor and can be used for preparing vaccine for preventing and treating tumor.

Description

technical field [0001] The invention relates to the fields of genetic engineering and protein engineering, in particular to polypeptides derived from animals, especially CD40 ligands. Background technique [0002] CD40L / CD40 plays an important role in both cellular and humoral immunity. As a co-stimulatory molecule for immune cell activation, CD40L participates in the body's anti-tumor immune response. CD40 ligand (CD40 ligand, CD40L), also known as CD154, is a type II transmembrane glycoprotein belonging to the tumor necrosis factor superfamily. It is mainly expressed in CD4+ T cells, and a part is also expressed in activated B cells and platelets. B cell surface CD40 binding. As a result, on the one hand, B cells are stimulated to secrete IL-4, which combines with IL-R to induce B cells to express B7-1 / B7-2; on the other hand, it directly induces the expression of B7-1 / B7-2. B7-1 / B7-2 binds to CD28 / CTLA-24 molecules on the surface of T cells and provides a second signal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N1/15C12N1/19C12N1/21A61K39/00A61P35/00
Inventor 高基民张振李金龙许晓玲
Owner WENZHOU MEDICAL UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More