Unlock instant, AI-driven research and patent intelligence for your innovation.

Streptavidin-interleukins 2 fusion protein

A technology of interleukin and fusion protein, applied in the field of interleukin-2, which can solve the problems of limited anti-tumor clinical effect, time-consuming preparation of autologous tumor cell vaccine, and difficulty in achieving effective concentration

Inactive Publication Date: 2008-03-26
SOUTHERN MEDICAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the preparation of tumor cell vaccines by gene modification has the following inherent defects: the efficiency of modification is generally low (especially in situ gene transfection or transduction), and depends on the type of tumor cells; It is difficult to achieve the effective concentration of the protein expression product locally and maintain it for a long time, so the actual anti-tumor clinical effect is very limited; due to individual differences and the inconsistency of the survival status of tumor cells when obtaining tumor samples, some patients often fail to provide survival information. Tumor cells in good condition cannot eventually be made into autologous tumor cell vaccines; there are often potential viral vector safety issues (so-called "genotoxicity") and immunogenicity issues (repeated use of the same viral vector will affect the expression efficiency of the introduced gene ); it is difficult to efficiently express multiple synergistic immunostimulatory factors at the same time, and to precisely control their expression
In addition, the preparation of genetically modified autologous tumor cell vaccines is time-consuming, and it is not easy to carry out large-scale and widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptavidin-interleukins 2 fusion protein
  • Streptavidin-interleukins 2 fusion protein
  • Streptavidin-interleukins 2 fusion protein

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0028] Preparation of Example 1 Fusion Protein IL2-L-SA-6His

[0029] 1. Use the DNeasy tissue kit to extract bacterial genomic DNA from Streptomyces avidin, and then use it as a template to prepare mature streptavidin cDNA by PCR with Platinum pfx DNA polymerase.

[0030] Primer: 5'GGAATTCTCAAGCGGGGGCAGCGGGGGCGGAGGCAGCGGCGGGGGCGGATCCG CCGACCCCTCCAAGGACTCGAAGGCC 3'(78nt) and

[0031] 5'GTGGTGCTCGAGCTGCTGAACGGCGTCGAGCGGGTTGCC 3' (39nt).

[0032]Reaction conditions: denaturation at 94°C, 2min, cycle (94°C, 15s→60°C, 15s→68°C, 30s) for 25 rounds, and finally 68°C, 5min.

[0033] 2. Extract the total RNA of PHA-activated peripheral blood lymphocytes with Trizol, and use it as a template for RT-PCR to prepare mature IL-2 cDNA.

[0034] Primers: 5'CATGCCATGGCTCCTACTTCAAGTTCTACAAAG 3'(33nt) and

[0035] 5'GGAATTCAGTCAGTGTTGAGATGATGCTTTG 3'(31nt)

[0036] Reaction conditions: denaturation at 94°C, 2min, cycle (94°C, 15s→60°C, 15s→68°C, 30s) for 25 rounds, and finally 68°C, 5min. ...

example 2

[0050] Preparation of Example 2 Fusion Protein 6His-SA-L-IL2

[0051] 1. Preparation of mature streptavidin cDNA: the method is the same as in Example 1.

[0052] Primers:

[0053] 5'GGAATTCCATATGCATCATCACCATCACCATGAGGCCGGCATCACCGGCACCTGG3' (55nt) and

[0054] 5' GGAATTCGGCGGATCCGCCCCCGCCGCTGCCTCCGCCCCCGCTGCCCCCGCTCGTCTGCTGAACGGCGTCGAGCGGGTTGCC 3' (82nt).

[0055] 2. Preparation of mature IL-2 cDNA: the method is the same as in Example 1.

[0056] Primers:

[0057] 5'GGAATTCATGGCTCCTACTTCAAGTTCTAC 3'(30nt)

[0058] and 5' CCCAAGCTTTCAAGTCAGTGTTGAGATGATGCTTTG 3' (36nt).

[0059] 3. Construction of 6His-SA-L-IL2-pET24 recombinant plasmid

[0060] Prepared SA cDNA (without termination code, containing NdeI and EcoRI restriction endonuclease sites at both ends) and IL-2 cDNA (respectively containing EcoRI and HindIII restriction endonuclease sites at both ends), the above SA and IL-2 gene fragments were cloned into the pET-24a vector to obtain the 6His-SA-L-IL2-pET24 recomb...

example 3

[0066] Example 3 Preparation of IL2-L-SA-6His or 6His-SA-L-IL2 Fusion Protein Modified Tumor Vaccine

[0067] will be 10 7 Suspend B16.F10 cells in 1ml 1×PBS, add 0.5mg Sulfo-NHS-LC-Biotin and mix well, then act at room temperature for 30 minutes; wash the cells 3 times with 1×PBS, 6 Add 200ng IL2-L-SA-6His or 6His-SA-L-IL2 fusion protein to each B16.F10 cell, and let it act on ice for 30 minutes; wash the cells once with 1×PBS, and then inactivate with γ-rays (20000rad). .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides one kind of fusion protein, which consists of one chain avidin and one interleukin-2 connected through one junctional peptide in the amino acid sequence of SerSerGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGly Ser. The fusion protein has the activity of both chain avidin and interleukin-2, and can have its interleukin-2 anchored to the surface of biotinylated tumor cell by means of the powerful joint between the chain avidin and the biotin and exist stably on the surface of gamma ray deactivated tumor cell while maintaining the activity of interleukin-2. The tumor vaccine surface modified with the fusion protein has the functions of preventing and treating tumor.

Description

technical field [0001] The invention relates to the fields of genetic engineering and protein engineering, in particular to polypeptides derived from animals, especially interleukin-2. Background technique [0002] Interleukin-2 (Interleukin-2, IL-2) is a T cell growth factor and a signal regulator molecule, which has a very important role in immune regulation. It has the following functions: promote T cell proliferation, increase the activity of cytotoxic T cells, NK cells and monocytes; induce B cell growth and antibody production; induce lymphocytes in peripheral blood to be derived into LAK cells; induce secondary cytokine secretion, Such as TNFαt, GM-CSF, IFN, etc.; enhance the expression of IL-2 receptor on the surface of T cells. Therefore, IL-2 has the functions of anti-virus, anti-tumor and enhancing the immune function of the body. IL-2 gene is often used to modify tumor cells and prepare tumor cell vaccines to enhance the immunogenicity of tumor antigens. The t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62A61K38/16A61K39/00A61P35/00
Inventor 高基民胡志明周明乾林来新妹
Owner SOUTHERN MEDICAL UNIVERSITY