Preparation for porcine defensin engineering yeast strain
A technology of porcine defensin and yeast engineering, applied in the fields of biotechnology and genetic engineering pharmacy, can solve the problems such as the preparation method and technology of recombinant porcine defensin which have not yet been seen, and achieve the effects of reducing production cost and improving antibacterial activity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0019] (1) Transformation of porcine β-defensin-2 gene
[0020] Collect 100ml of fresh anticoagulated pig blood, centrifuge and take buffy coat, use Trizol method to prepare total RNA from pig white blood cells, design upstream and downstream primers according to animal defensin conserved sequence, upstream primer: 5'-gcgg ggtacc accatgagggccctctgcttg, downstream primer: 5'-ctag tctaga tcagcggatgcagcacttg. The porcine defensin gene was amplified by RT-PCR, and the gene was cloned into the KpnI and XbaI sites of the eukaryotic expression vector pcDNA3.1 produced and sold by Invitrogen Company of the United States through restriction sites to construct eukaryotic expression carrier.
[0021] Using the site-directed mutagenesis method, refer to the sequence of other animal defensins, carry out site-directed mutations on the porcine defensin gene, obtain several mutants, express the mutant genes in cultured 293T cells, and purify the expression product—porcine defensin from th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
