Unlock instant, AI-driven research and patent intelligence for your innovation.

A PCR-LDR gene polymorphism detection and sequencing method with fluorescent labeling probe

A technology of PCR-LDR and gene polymorphism, which is applied in biochemical equipment and methods, microbial determination/inspection, measuring devices, etc., can solve the problems of expensive probes, inconvenient development and application, and reduce application costs , Accelerate the speed of detection, and the effect of correct detection results

Active Publication Date: 2011-11-30
上海翼和应用生物技术有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there have been the associated use of LDR technology and PCR technology, and the association of LDR technology, PCR technology, gene chip technology, and sequencing technology for gene polymorphism site detection (Norman P.Gerryl et al., J.Mol.Biol .(1999) 292,251-262, U.S.Pat.Pub.No.2003 / 0032016A1), the appearance of these technologies greatly facilitates the detection of gene loci, but in these technologies, a large amount of fluorescently labeled probes are required, However, these labeled probes are expensive, causing inconvenience to development and application, thus limiting their application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A PCR-LDR gene polymorphism detection and sequencing method with fluorescent labeling probe
  • A PCR-LDR gene polymorphism detection and sequencing method with fluorescent labeling probe
  • A PCR-LDR gene polymorphism detection and sequencing method with fluorescent labeling probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Detection of DNA polymorphisms with single point mutations

[0048] Taking the 1896 site mutation of hepatitis B virus (HBV) DNA as an example, the interval between the mutation sites is 5 bases.

[0049] The sequence near the HBV1896 site is:

[0050] 5'GCTGTGCCTTGGGTGGCTTTG / AGGGCATGGACATTGACCCG3'

[0051] 1. Primer and Probe Design

[0052] (1) General PCR primer design

[0053] Primer sequence (5'→3') Length (nt) upstream primer CACCTCTGCCTAATCATCTCATGTTCATGT 30 downstream primer ACACAGAATAGCTTGCCTGAGTGCTGTATG 30

[0054] (2) Fluorescent labeling probe: GCATCACTCAGAGGG

[0055] Template: CCCTCTGAGTGATGCGAGTACAGGTTTGCG

[0056] Fluorescently labeled probes need to be 5' phosphorylated and 3' probe labeled (FAM is used in this case).

[0057] (3) Labeled probe

[0058] probe name Probe sequence (5'→3') Length (nt) Pair with template

part

AAAGCCACCCAAGGCACA

18 and a generic templat...

Embodiment 2

[0070] Example 2: Detection of DNA polymorphisms of two point mutations

[0071] Taking HBV1896 site and YIDD / YMDD mutation as an example to detect single-site DNA polymorphism, the interval between each mutation site is 5 bases.

[0072] HBV1896 mutation:

[0073] 5'GCTGTGCCTTGGGTGGCTTTG / AGGGCATGGACATTGACCCG3'YIDD / YMDD mutation of HBV:

[0074] 5'CTGTCTGGCTTTCAGTTATATG / TGATGATGTGGTATTGGGGG3'

[0075] 1. Primer and Probe Design

[0076] (1) General PCR primer design

[0077] HBV1896 primer sequence (5'→3') Length (nt) upstream primer CACCTCTGCCTAATCATCTCATGTTCATGT 30

[0078] downstream primer ACACAGAATAGCTTGCCTGAGTGCTGTATG 30 HBV YIDD / YMDD primer sequence (5'→3') Length (nt) upstream primer CAAGGTATGTTGCCCGTTTGTCC 30 downstream primer GG(CT)A(AT)AAAGGGACTCA(AC)GATG 30

[0079] (2) Fluorescent labeling probe: GCATCACTCAGAGGG

[0080] Template: CCCTCTGAGTGATGCGAGTACAGGTTTGCG

[0081] Fluorescently labele...

Embodiment 3

[0095] Example 3: Simultaneous detection of polymorphisms at multiple sites (SNPs) in the human genome

[0096] At the same time, five SNP sites (rs4652678, rs199930, rs7043268, rs6424820 and rs4133072) were subjected to SNP typing, and the interval between each SNP mutation site was 5 bases.

[0097] 1. Primer and Probe Design

[0098] (1) General PCR primer design

[0099] rs4652678 primer sequence (5'→3') Length (nt) upstream primer CTTCTGTAGAATGAGGTATAGTGAGGAGGC 30 downstream primer GTCAGCAGAGCCCAGATAATGTTGTCGTAG 30 rs199930 primer sequence (5'→3') Length (nt) upstream primer GAGGGCTGGCAGGAGATTATGCTGTCATGC 30 downstream primer GGTAAAAGCACAATGTTGCTCACCAAGAAG 30 rs7043268 primer sequence (5'→3') Length (nt) upstream primer CTCTGGATTTGACATTGCTTTTCAGGAGTG 30 downstream primer TTAGTGAGAGGGATCAGGAAACCAAGGAAG 30 rs6424820 primer sequence (5'→3') Length (nt) upstream primer AGGACGGGACCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a PCR-LDR gene polymorphism detection and sequencing method using a fluorescent label probe. The invention utilizes fluorescent label probes to perform PCR-associated LDR and sequencing techniques to detect gene polymorphism sites. The method of the invention comprises the following steps: primer and probe design, PCR detection, LDR detection, sequencer result detection. Due to the directness of the sequencing results, the method of the present invention solves the false positive and false negative results; the high-throughput of the samples of the sequencing platform can simultaneously detect hundreds of samples; The unique 5-color fluorescence detection system can use 4 kinds of fluorescence at the same time, so that the sequencer system can also detect more than 100 sites at the same time, speeding up the detection speed and reducing the experimental cost.

Description

technical field [0001] The invention relates to biotechnology, in particular to a PCR-LDR gene polymorphism detection and sequencing method using fluorescent labeling probes. Background technique [0002] With the development of human pharmacogenomics, more and more research results will be applied to clinical diagnosis, which requires a large-scale detection method of gene polymorphism sites. In recent years, the ligation reaction is used to detect gene polymorphic sites more and more people's attention, scholars have done a lot of research (France Barany et al., Proc.Nat'l Acad.Sci.USA, 88 : 189-93 (1991), The Ligase Chain Reaction (LCR) in a PCR World, PCR Methods and Applications, 1: 5-16 (1991)). Ligase chain reaction (ligase chain reaction, LCR) refers to the design of two pairs of probes in the reaction, so that the ligation reaction can exponentially amplify the template. In the ligase detection reaction (LDR), only a pair of probes are added to the reaction, and t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N21/00C12Q1/68
Inventor 肖君华陆炯陈轶群
Owner 上海翼和应用生物技术有限公司