Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test paper strip for detecting swine chain coccus type 2 antibody colloidal gold, method for making same and applications

A technology of streptococcus suis and detection test paper, which is applied in measurement devices, instruments, scientific instruments, etc., can solve the problems of requiring professionals, complicated operation, expensive instruments, etc., and achieves the effect of easy promotion, simple operation, and clear and easy to distinguish results.

Inactive Publication Date: 2009-02-11
BEIJING ZHUANGDI HAOHE BIOMEDICINE SCI & TECH
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] With the continuous development of immune technology, fingerprints and nucleic acid amplification (PCR) have appeared successively, but there are problems such as requiring expensive instruments, complicated operation, long time, and professional personnel.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for detecting swine chain coccus type 2 antibody colloidal gold, method for making same and applications
  • Test paper strip for detecting swine chain coccus type 2 antibody colloidal gold, method for making same and applications
  • Test paper strip for detecting swine chain coccus type 2 antibody colloidal gold, method for making same and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Cloning expression of embodiment 1 Streptococcus suis type 2 specific antigen MRP

[0039] (1) Amplification of MRP gene

[0040] PCR primer design

[0041] According to the fragment to be amplified, a pair of primers were designed, and Sac I and Hind III restriction sites and protective bases were added to the two ends of the primers respectively. Primers P1 and P2 can amplify the open reading frame of Streptococcus suis type 2 MRP gene ( ORF) 529bp fragment between 298~827bp. (MRP gene GenBank accession number is EF520110)

[0042] The primer sequences are:

[0043] Upstream primer P1: 5′2GTAGAGCTCGAACAGGTAACATCAGA3′;

[0044]Downstream primer P2: 5'2CAGAAGCTTAAGAGTAACGAATGTAGG3'.

[0045] PCR amplification

[0046] Each reactant was sequentially added in the following order and conditions and PCR amplification was performed. Template DNA 2μL, 10×buffer 10μL, 25mmol / L MgCl 2 8 μL, 215 mmol / L dNTPs 8 μL, primers P1 and P2 (0.1 μmol / L) each 1 μL, ddH 2 O 68 μL...

Embodiment 2

[0056] Embodiment 2: the development of anti-Streptococcus suis type 2 MRP protein monoclonal antibody cell line

[0057] (1) Immunized mice

[0058] The prepared genetically engineered antigen was used to immunize BALB / C mice with a certain dose. The immune effect was detected by ELISA method.

[0059] (2) Myeloma cells

[0060] SP2 / 0 myeloma cells: resuscitate SP2 / 0 cells stored in a liquid nitrogen tank, and culture them in DMEM medium containing 10% calf serum for 48-72 hours, until the cells grow well, the cells are round, transparent, and uniform in size , neatly arranged, logarithmically split, and ready for fusion.

[0061] (3) cell fusion

[0062] Prepared SP2 / 0 cells and splenic lymphocytes of immunized BALB / C mice were prepared in 2×10 7 / ml and 1×10 8 / ml. Take 1ml of each and mix at room temperature. 0.8 ml of 50% PEG (molecular weight 1500) was used as fusion agent; 10% calf serum DMEM was used as culture medium.

[0063] (4) Detection and screening of p...

Embodiment 3

[0070] Embodiment 3: the detection of anti-Streptococcus suis type 2 MRP monoclonal antibody

[0071] (1) Monoclonal antibody ascites preparation:

[0072] Mice: SPF grade mice, no rodent virus contamination after inspection, if the animals are found to be unhealthy, bitten or infected during the ascites production process, they should be discarded.

[0073] Expanded culture of cell lines: Take one tube of the production batch of cells to resuscitate, add nutrient solution to expand the culture, one tube of production cells is only used once, and will not be frozen.

[0074] Inoculation of hybridoma cell lines: preparation of ascites should be carried out under sterile conditions, before injection of hybridoma cells, each mouse was intraperitoneally injected with liquid paraffin 0.5ml. One week later, each mouse was intraperitoneally injected with 1-3×10 hybridoma cells. 6 / 0.2ml.

[0075] Ascites collection: 7 to 10 days after injecting the cell line, or the ascites was co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention provides a colloidal gold test strip for detection of Streptococcus suis (serotype2). A monoclonal antibody of Streptococcus suis (serotype2) specific antibody MRP or polyclonal antibody of Streptococcus suis (serotype2) specific antigen, and a quality control second antigen IgG are coated on a nitrate cellulose film (NC film), and a membrane chromatography double antibody sandwich method is adopted to detect the Streptococcus suis (serotype2) specific antigen in a specimen in combination with a monoclonal antibody of 9i8kvbkikl colloidal gold labeled Streptococcus suis (serotype2) specific antibody MRP. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, large scale site detection of an accident and epidemiological investigation, and has auxiliary effect on the diagnosis of Streptococcus suis (serotype2) infection.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a test strip for detection of Streptococcus suis type 2 colloidal gold, its preparation method and its application. Background technique [0002] Streptococcus suis can cause diseases such as meningitis, arthritis and sepsis in pigs, and can cause sudden death in young pigs. The bacterium can also cause human infection, leading to serious diseases such as meningitis, and is an important zoonotic pathogen. There are 35 serotypes of Streptococcus suis, among which Streptococcus suis type 2 has a global distribution and the highest proportion of clinical isolates. In Streptococcus suis type 2, there are virulent, weak and avirulent strains with different virulence. The biggest difference between the virulent strain and the avirulent strain is that the former is MRP + , while the latter is MRP - . MRP + Streptococcus suis can often cause severe clinical symptoms,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner BEIJING ZHUANGDI HAOHE BIOMEDICINE SCI & TECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More