Avid kyowamycin genetic engineering bacterium and use thereof
A technology of Streptomyces avermitilis and genetically engineered bacteria, applied in the field of microbial fermentation and genetic engineering, can solve the problems of low fermentation unit and high production cost, and achieve the effects of reducing production cost and increasing yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1. Construction of frr gene expression vector
[0023] 1. Construction of recombinant plasmid containing frr gene and its own promoter
[0024] 1. Amplification of frr gene containing its own promoter
[0025] Design primers for PCR amplification of the frr gene containing its own promoter located on the chromosome of Streptomyces avermitilis [NC_003155.4(3224362...3223805)], the upstream primer PrimerF1 (CCGACATGACCGCGATCAC) is located 300bp upstream of the frr start codon , The downstream primer PrimerR1 (CG GAATTC GTCATGCGCATCGTACGTGG, the underlined base is the recognition site of the restriction enzyme EcoRI) is located 150bp downstream of the frr stop codon, and the amplified product should be 976bp.
[0026] Using the total DNA of the wild-type strain ACTT31267 of Streptomyces avermitilis as the template, PrimerF1 and Primer R1 as primers, PCR amplification was carried out. The amplification conditions were 95℃, 4min; (95℃, 1min; 60℃, 1min; 72℃, 1min)×25 cycles...
Embodiment 2
[0035] Example 2. Transformation of recombinant plasmid
[0036] In Example 1, a total of four expression plasmid vectors for frr genes were constructed, namely pFR1-1139, pFR1-152, pFR4-1139 and pFR4-152, and the original plasmids used as controls were pKC1139 and pSET152. The characteristics of these six plasmids are briefly described (Table 1).
[0037] Table 1 The characteristics of recombinant plasmids containing frr gene and original plasmids
[0038]
[0039] Due to the strong restriction and modification effect in Streptomyces avermitilis, direct transformation of Streptomyces avermitilis with plasmids derived from E.coli DH5α results in extremely low transformation efficiency and sometimes even no transformants can be obtained. Using plasmids from the recipient strain E.coli ET12567, which has no restricted modification effect, its transformation efficiency is significantly improved. Therefore, the constructed recombinant plasmid and control plasmid were first transformed ...
Embodiment 3
[0042] Example 3. Fermentation study of transformants
[0043] 1. Research on fermentation of ATCC31267 and its transformants
[0044] 1. Shake flask fermentation of Streptomyces avermitilis
[0045] Seed medium: soluble starch 30g, malt extract 2g, soy peptone 2g, CoCl 2 ·6H 2 O5mg, add distilled water to 1L, adjust the pH to 7.0-7.2.
[0046] Fermentation medium: 50g soluble starch, 12g yeast powder, MgSO 4 ·7H 2 O0.5g, K 2 HPO 4 ·3H 2 O0.5g, KCl4g; CaCO 3 2g, CoCl 2 ·6H 2 O5mg, add distilled water to 1L, adjust the pH to 7.0-7.2.
[0047] The wild-type strain ATCC31267 of Streptomyces avermitilis and its different transformants grow abundant spores on the YMS medium and then inoculate them in the seed medium (100mL / 500mL Erlenmeyer flask), and culture at 28℃ in a shaker for 24 hours ( Rotation speed 180rpm, eccentricity 2.5cm). Inoculate 5% inoculum into the fermentation medium (50mL / 300mL Erlenmeyer flask), culture at 28°C for 10 days (rotating speed 250rpm, eccentricity 2.5cm), p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 