Adenovirus vector avian influenza recombinant vaccine

A technology of avian influenza and recombinant adenovirus, which can be applied in the direction of virus/phage, antiviral agent, recombinant DNA technology, etc.

Active Publication Date: 2009-07-08
ZHEJIANG YEBIO BIOTECH +1
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because all inactivated vaccines use attenuated avian influenza H5N2 as the vaccine strain or recombinant H5N1 as the vaccine strain, the production process needs to reproduce the live virus, and objectively there is the possibility of loose virus; the attenuated Newcastle disease avian influenza recombinant II The practical application of the vaccine is limited by the immunization program, and the popularization and application encounter certain difficulties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adenovirus vector avian influenza recombinant vaccine
  • Adenovirus vector avian influenza recombinant vaccine
  • Adenovirus vector avian influenza recombinant vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1. Construction and production of recombinant adenovirus encoding the HA antigen gene of integrated hsp

[0084] Design and synthesis (obtain HA and hsp genes by conventional PCR method, then form after re-cloning and recombination in the vector) the following sequence (SEQ ID NO: 1):

[0085] GCCACCatggagaaaatagtgcttcttcttgcaatagtcagtcttgtcaaaagtgatcagatttgcattggttaccatgcaaacaactcgac

[0086] agagcaggttgacacaataatggaaaagaacgttactgttacacatgcccaagacatactggaaaggacacacaacgggaagctctgcgatc

[0087] taaatggagtaaagcctctcattttgagagattgtagtgtagctggatggctcctcggaaaccctatgtgtgacgaattcaccaatgtgccg

[0088] gaatggtcttacatagcggagaaggccagtccagccaatgacctctgttacccaggggatttcaacgactatgaagaactgaaacacctatt

[0089] gagcagaataaaccattttgagaaaattcagatcatccccaaaagttcttggtccaatcatgatgcctcatcaggggtgagctcagcatgtc

[0090] cacaccatgggaagtcctcctttttcagaaatgtggtatggcttatcaaaaagaacagtacatacccaaataaagaggagctacaataat

[0091] accaaccaagaagatcttttggtactgtgggggattcaccatcctaatgatgcggcagagcagacaa...

Embodiment 2

[0128] Example 2. Identification of specific target HA gene in recombinant adenovirus

[0129] The grown 293 cells (purchased from ATCC) were infected with recombinant adenovirus rAd-HAhsp70 or rAd-HA. After the cells appeared typical and uniform lesions, the cells were collected and treated to extract DNA and amplify with specific primers. Waiting until the corresponding fragment results in something like figure 1 shown.

[0130] Specific primers are as follows:

[0131] HA F: 5'-aaggatccgccaccatggagaaaatagtgct-3' (SEQ ID NO: 3);

[0132] HA R: 5'-gtcaagcttttaaatgcaaattctgcatt-3' (SEQ ID NO: 4).

[0133] Among them, the shuttle plasmid pShuttle-IRES-hrGFP-1 and the backbone plasmid Ad-Easy1 used to construct the recombinant rAd-GFP were purchased from Stratagene Company in the United States. In bacillus BJ5183, an adenovirus plasmid carrying GFP was obtained, and then the plasmid was digested with Pac1 and then transfected into 293 cells, so as to obtain rAd-GFP virus use...

Embodiment 3

[0134] Example 3. Western blot analysis of adenovirus-mediated expression of HAhsp70 in 293 cells

[0135] In order to determine whether the HAhsp70 gene constructed by the present inventors can be expressed in cells through the adenovirus vector, the recombinant rAd-HAhsp70 virus particles were infected to 293 cells. Two days later, the protein in the cells was extracted, and the expression of the HAhsp70 fusion gene was analyzed by Western blot. The antibody used for identification was a polyclonal antibody of chicken origin (purchased from Harbin Veterinary Research Institute).

[0136] The result is as figure 2 , H5N1HA (lane 2) expressed the corresponding protein.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an adenovirus carrier avian influenza recombined vaccine. The vaccine takes the hemagglutinin antigen gene of highly pathogenic avian influenza H5N1 as a main protective antigen gene which is fused with a braided mycobacterium tuberculosis heat shock protein coding gene. After being transferred into an adenovirus carrier to obtain a recombined adenovirus and immunize an animal, the fusion gene can produce a high titer antibody of the hemagglutinin antigen HA inside the animal and keep a high antibody titer inside the animal for a long period.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically, the invention relates to an adenovirus vector avian influenza recombinant vaccine. Background technique [0002] Avian Influenza (Avian Influenza, AI) is a variety of disease syndromes of poultry (poultry and wild birds) from respiratory system to severe systemic sepsis caused by type A influenza virus. The disease is defined as a Class A infectious disease by the World Organization for Animal Health (OIE), and is also listed as a Class I animal disease by China. Since the first outbreak of the disease in chicken flocks in Italy in 1878, there have been reports of outbreaks in various parts of the world, including North America, South America, North Africa, the Middle East, the Far East, the United Kingdom and the former Soviet Union, especially since the end of 2003. The avian influenza caused by the H5N1 subtype highly pathogenic avian influenza virus has been widespread in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/861C12N7/01A61K48/00A61K39/145A61P31/16
Inventor周立桥
OwnerZHEJIANG YEBIO BIOTECH