Tobacco receptor albuminoid kinase gene and application thereof

A protein kinase gene, tobacco technology, applied in application, genetic engineering, plant genetic improvement and other directions to achieve the effect of improving resistance

Inactive Publication Date: 2009-10-07
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cloning of black shank resist...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco receptor albuminoid kinase gene and application thereof
  • Tobacco receptor albuminoid kinase gene and application thereof
  • Tobacco receptor albuminoid kinase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Embodiment 1: Acquisition and expression of tobacco receptor-like protein kinase gene (NrRLK):

[0056] 1. Utilize the conserved sequences of kinase-like disease-resistant genes that have been cloned in other crops

[0057] ( ATGGGAAGCAAGTATTCCAA GGCAACAAATTCCATAAATGATGCTTCTAACTTGAGTTATGGCATTCCTTTTGAAAATTATCGAGTTCCTTTTGTAGATTTGGAGGAAGCAACTAACAACTTTGATGACAAGTTTTTCATTGGAGAGGGTGGATTTGGGAAGGTTTACAGGGGTGTTTTGCGTGATGGAACAAAGGTCGCCCTGAAAAAGCATAAACGTGAGTCCTCACAAGGTATTGAAGAGTTCGAAACAGAAATTGAGATTCTCTCATTTTGCAGCCATCCGCATCTGGTTTCATTGATAGGATTCTGTGATGAAAGAAATGAGATGATTCTAATTTATGACTACATGGAGAATGGGAACCTCAAGAGCCATTTGTATGGCTCAGATCTACCCACTATGAGCATGAGCTGGGAGCAGAGGCTGGAGATATGCATAGGGGCGGCCAGAGGTCTTCACTACCTTCATACTAACGGAGTTATACATCGTGATGTCAAGTGTACAAACATATTGCTTGATGAGAATTTTGTGCCAAAAATTACTGATTTTGGAATATCTAAGACAATGCCCGAGCTTGATCAAACCCATCTTAGCACAATAGTGAGAGGAAATATAGGCTACATTGCCCCTGAATATGCTTTGTGGGGACAGCTGACAGAAAAATCTGATGTTTATTCTTTCGGTGTTGTTTTATTCGAAGTTCTTTGTGCTAGGCCTGCCCTATATCTTTCAGAGATGATGAGTTCTGATGATGAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the cloning of a tobacco receptor albuminoid kinase gene, belonging to the field of plant genetic engineering. The invention clones a full-length sequence of a tobacco receptor albuminoid kinase (NrRLK) gene cDNA, therefore, a semi-quantitative PCR (RT-PCR) method for a pair NrRLK gene specific primer is designed for detecting the expression of reactive wild tobacco N. rependa in different periods after the inoculation with phytophthora parasitica, and the result shows that the gene is expressed only after being infected for 9 days by the phytophthora parasitica. The analysis on the theoretic amino acid sequence encoding the gene shows that the protein can be involved in plant defense response, so the gene can have a direct relationship with the resistance of the phytophthora parasitica. Taking the gene as a target gene, by the method of genetic engineering, the resistance of existing tobacco to the phytophthora parasitica is improved, and the tobacco variety with high resistance to black shank pathogen is cultivated to be used in tobacco production.

Description

Technical field: [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a tobacco receptor-like protein kinase gene, its acquisition method and its application in transgenic tobacco plants resistant to black shank pathogen. technical background: [0002] Tobacco is one of the important economic crops in our country. Since tobacco is harvested from tobacco leaves, the impact of diseases on tobacco yield and quality is more serious. Tobacco black shank was discovered in Java, Indonesia by Van Breda de Haan in 1896. It is one of the most serious diseases in the world's tobacco production. It is a devastating soil-borne fungal disease of tobacco caused by Phytophthora parasitica f.nicotianae, which mainly infects tobacco roots and stem bases, and is one of the main diseases of tobacco [Kong Fanyu, Zhu Xianchao, Shi Jinkai , etc. my country's tobacco infectious disease trends and control strategies. China Tobacco, 1995 (1): 31-34.]. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/54C12N15/10C12N15/11C12Q1/68A01H1/00A01H5/00
Inventor 高玉龙徐照丽焦芳婵陈学军卢秀萍肖炳光
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap