Use of a first house dust mite group 2 allergen for treating allergy to a second house dust mite group 2 allergen

A technology for allergens and allergies, applied in allergic diseases, allergen antigen components, animal/human peptides, etc., can solve life-threatening, multiple reactions, allergic side effects and other problems

Inactive Publication Date: 2009-12-02
ALK ABELLO SA
View PDF12 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Second, the irritating allergen (offending allergen) spreads, leading to allergic multiple reactions
Patients must stay under medical observation for 30 minutes after each injection because of the risk of allergic side reactions, which are generally rare but potentially life-threatening

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of a first house dust mite group 2 allergen for treating allergy to a second house dust mite group 2 allergen
  • Use of a first house dust mite group 2 allergen for treating allergy to a second house dust mite group 2 allergen
  • Use of a first house dust mite group 2 allergen for treating allergy to a second house dust mite group 2 allergen

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0045] The preparation of vaccines is generally well known in the art. Allergens can be suitably mixed with excipients that are medicinal and also compatible with the active ingredient. Examples of suitable excipients are water, saline, dextrose, glycerol, ethanol, etc., and combinations thereof. The vaccine may additionally contain other substances such as wetting agents, emulsifying agents, buffering agents or adjuvants to enhance the effect of the vaccine.

[0046] Vaccines can be appropriately formulated with the following excipients commonly used in such formulations, such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like.

[0047] The vaccine should be administered in a manner that matches the dosage formulation and in an amount that is therapeutically effective and immunogenic. The amount of active ingredient included in the vaccine depends on the subject to be treated (ie, the abi...

Embodiment 1

[0082] Example 1: SLIT treatment with recombinant DER F2 and DER P2

[0083] Methods and Materials:

[0084] Expression and purification of rDer f2 and rDer p2 from E. coli

[0085] 用PCR反应扩增编码Der f2和Der p2的cDNA,所使用的引物为derp2DOndeI:gcgcgccatatggatcaagtcgatgtcaaag,derp2UPxhoI:gcgcgcctcgag ttaatcgcggattttagcatg,derf2DOndeI:gcgcgccatatggatcaggtcgatgtcaaag,derf2UPxho1:gcgcgcctcgag ttaatcgcggattttagcgtg,且以携带Der f2和Der p2的cDNA的质粒( pCo06 and pCo10) as templates. The PCR product was cloned into the pETDuet-1 vector, resulting in an additional N-terminal methionine. This vector was introduced into E. coli strain BL21(DE3). Expression of rDer f2 and rDer p2 proteins was induced by adding 1 mM isopropyl-β-thiogalactoside (IPTG) and incubating overnight at 37°C. The purified inclusion bodies were dissolved in 8M urea, 20mM Tris pH8.5 overnight. Proteins were refolded by rapidly diluting to a final concentration of 0.65M urea and incubating for 1 hour at room temperature. Precipitate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the use of a Der f 2 allergen composition for the manufacture of a vaccine for preventing or treating allergy to Der p 2, as well as to the use of a Der p 2 allergen composition for the manufacture of a vaccine for treating allergy to Der f 2.

Description

technical field [0001] The present invention relates to the use of a Der f2 allergen composition in the preparation of a vaccine for the prevention or treatment of allergy to Der p2, and also relates to the use of a Der p2 allergen composition in the preparation of a vaccine for the treatment of allergy to Der f2 the use of. Background of the Invention [0002] Allergies are a major health problem in countries with Western lifestyles. Moreover, the prevalence of allergic diseases is increasing in these countries. While allergies are generally not considered life-threatening conditions, asthma is responsible for a large number of deaths each year. The unusual prevalence of about 30% among adolescents, in particular, represents a significant reduction in their quality of life, as well as a significant loss of working time and money, which requires a classification of major health problems in the Western world. [0003] Allergy is a complex disease. Many factors contribute ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/435A61K39/35
CPCC07K14/43531A61K39/35A61P37/08C07K14/435
InventorB·罗斯
OwnerALK ABELLO SA