Preparation method of long probe capable of being used in multiplex ligation amplification technology
A technology of multiple ligation and long probes, applied in the field of oligonucleotide probe preparation, can solve the problems of difficult design, high cost and high cost, and achieve the effects of simple primer design, lower threshold, and simple and easy operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1 selects UT template and designs synthetic primers
[0037] Select the plasmid pET-49b (purchased from Novagen) as the template nucleotide sequence (UT) that has nothing to do with the target fragment to be detected, and design and artificially synthesize universal primers based on the neomycin resistance gene and the nucleotide sequence of pET-49b and detection primers;
[0038] The detection primer is named CP+GSS2, and its nucleotide sequence is specifically:
[0039] 5'- GCTCATACAAATGCTCTTCA --3'
[0040] The sequence in the wire frame is GSS2, which is designed according to the neomycin resistance gene nucleotide sequence; the underlined part of the sequence is CP, which is designed according to the pET-49b nucleotide sequence, and the 5' end is phosphorylated;
[0041] Described universal primer is called GP2, and its nucleotide sequence is:
[0042] 5'--TAATACGACTCACTATAGGG--3'
[0043] Its 5' end is labeled with biotin.
[0044] GP is the ab...
Embodiment 2
[0047] Embodiment 2PCR amplification
[0048] Using the plasmid pET-49b as a template, PCR amplification was carried out with primers CP+GSS2 and GP2,
[0049]1) PCR reaction system:
[0050] reaction system
Volume: 20μl
concentration
10×pfu PCR buffer
2μl
1×
dNTP (10μM)
0.8μl
0.4μM
pfu enzyme (5U / μl)
0.4μl
0.1U / μl
Primer (up / downstream) (10μM)
0.8μl
0.4μM
h 2 o
15.5μl
template
0.5μl
[0051] 2) PCR reaction program
[0052] 95°C for 5 minutes;
[0053] 94℃ 30sec,
[0054] 50℃ 30sec,
[0055] 72℃ 40sec, 35cycles;
[0056] 10min at 72°C;
[0057] 10°C hold.
Embodiment 3
[0058] Embodiment 3PCR product purification and mixing with avidin magnetic beads
[0059] The product obtained by embodiment 2 PCR amplification is purified, comprising the following steps:
[0060] 1) Add 1 / 10 volume of 3M sodium acetate (PH5.2) to the PCR product and mix well;
[0061] 2) Add 2.5 times the volume of 95% ice ethanol and mix well;
[0062] 3) Place at -20°C for 2-3 hours, centrifuge at 14,000rpm for 5min, and remove the supernatant;
[0063] 4) Wash with 70% ethanol, centrifuge at 14,000rpm for 5min, remove supernatant, and dry;
[0064] 5) Add appropriate amount of deionized water to dissolve.
[0065] Preparation of Avidin Magnetic Beads
[0066] 1) Resuspend the avidin magnetic beads, and calculate the required amount of avidin magnetic beads according to the binding capacity of the avidin magnetic beads (every 1 μg of PCR product is biotin-labeled double-stranded nucleotide sequence and 10 μg avidin-labeled avidin magnetic beads), transfer the requir...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com