Ad5 D24 conditional reproduction type adenovirus carrier for expressing multiple exogenous genes, constructing method and application thereof

An exogenous gene, ad5d24 technology, applied to conditionally replicating adenovirus vector and its construction scheme and application field, can solve the problems of low tumor tissue infection efficiency, not very obvious therapeutic effect, limited number of expressed therapeutic genes, etc.

Inactive Publication Date: 2010-02-17
SHAANXI NORMAL UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to some shortcomings of this type of viral vector itself, such as low infection efficiency of tumor tissue and limited number of expressed therapeutic genes, etc., the therapeutic effect is not very obvious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ad5 D24 conditional reproduction type adenovirus carrier for expressing multiple exogenous genes, constructing method and application thereof
  • Ad5 D24 conditional reproduction type adenovirus carrier for expressing multiple exogenous genes, constructing method and application thereof
  • Ad5 D24 conditional reproduction type adenovirus carrier for expressing multiple exogenous genes, constructing method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Taking the Ad5 D24 conditionally replicable adenoviral vector expressing green fluorescent protein as an example, the construction method steps are as follows:

[0036] 1. Construction of a shuttle vector with 24 base deletions in Ad5E1A molecule CR2

[0037] By designing two pairs of primers, a gene sheet containing 24 base deletions in CR2 of Ad5E1A molecule was obtained through overlapping polymerase chain reaction. P1-P4 are the sequences of two pairs of primers:

[0038] P1: ATTAATTAACATCATCAATAATATACCTTATTTTGGATT;

[0039] P2: TCCTCGTCGTCACTGGGTGGAATCCAAAATAAGGTATATTATTGATGATG;

[0040] P3: CCACCCAGTGACGACGAGGATGAAGAGGGT GAGGAGTTT;

[0041] P4: TACTAGTCCGCTCTCCACAGA TGCATGGCCAG.

[0042] The polymerase chain reaction amplification conditions are: 94°C, 2 minutes, 94°C, 50 seconds, 55°C, 60 seconds, 72°C, 2 minutes, 30 cycles. The overlapping polymerase chain reaction products returned to fragments after electrophoresis with 1.0% agarose. Ligate the PCR fragm...

Embodiment 2

[0052] Taking Ad5 D24 conditionally replicable adenoviral vector expressing small interfering RNA targeting vascular endothelial cell growth factor and Arresten as an example, the construction method steps are as follows:

[0053] 1. Construction of a shuttle vector that deletes 24 bases in CR2 of the Ad5 E1A molecule

[0054] The procedure for constructing the shuttle vector with 24 bases deleted in CR2 of Ad5 E1A molecule was the same as that in Example 1, and the shuttle vector with 24 bases deleted in CR2 of Ad5 E1A molecule was obtained.

[0055] 2. Construction of the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2

[0056] The construction of the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2 was the same as in Example 1, and the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2 was obtained.

[0057] 3. Construction of adenovirus E4-fiber shuttle vector expressing small interfering RNA target...

Embodiment 3

[0064] Taking the Ad5 D24 conditionally replicable adenoviral vector expressing small interfering RNA (siHecl) targeting cancer highly expressed proteins and tumor necrosis factor-related apoptosis-inducing ligand (Trail) as an example, the construction method steps are as follows:

[0065] 1. Construction of a shuttle vector with 24 base deletions in Ad5 E1A molecule CR2

[0066] The procedure for constructing the shuttle vector with 24 bases deleted in CR2 of Ad5 E1A molecule was the same as that in Example 1, and the shuttle vector with 24 bases deleted in CR2 of Ad5 E1A molecule was obtained.

[0067] 2. Construction of the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2

[0068] The construction of the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2 was the same as in Example 1, and the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2 was obtained.

[0069] 3. Construction of an adenovirus E4-fi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an Ad5 D24 conditional reproduction type adenovirus carrier for expressing multiple exogenous genes. Ad5 E1 CR2 in a recombinant adenovirus carrier has 24bp basic group lack and is distinctively amplified in the tumor cells of pRB null / mutant; at least one expressing tumor treating gene or an expressing element of small-interfering RNA is inserted between the end of Fiberand the 5' end of an E4 area by adopting an E4-fiber shuttle carrier, and a promoter expressing element is inserted simultaneously. The constructing method of the Ad5 D24 conditional reproduction typeadenovirus carrier comprises the following steps: constructing a shuttle carrier with 24 basic group lacks in the CR2 of Ad5 E1A molecules; constructing an adenovirus carrier skeleton with 24 basic group lacks in the CR2 of the Ad5 E1A molecules; constructing the adenovirus E4-fiber shuttle carrier of the expressing treating gene or the small-interfering RNA; constructing a conditional reproduction type adenovirus carrier with 24 basic group lacks in the CR2 of the Ad5 E1A molecules expressing at least one treating gene or the small-interfering RNA and the treating gene; and expressing an application of the Ad5 D24 conditional reproduction type adenovirus carrier of multiple exogenous genes in preparing a medicine for treating tumors.

Description

technical field [0001] The present invention relates to the field of gene therapy and virus therapy, in particular to a conditional replication adenovirus vector and its construction scheme and application. Background technique [0002] Tumor is one of the serious diseases of human health at present, and no effective treatment method has been found except chemotherapy and radiotherapy. Therefore, it is extremely important to explore new treatment methods. As a new method of disease treatment, gene therapy has an important application prospect in tumor treatment. The key to gene therapy is the viral vector. Currently in tumor gene therapy, the most eye-catching viral vector is conditionally replicating oncolytic adenoviral vector (Conditionally Replicating oncolytic Adenoviral Vector, CRAD). This type of vector can be selectively amplified in tumor tissue, and the amplified virus can eventually kill the tumor, so it has obvious anti-tumor activity. [0003] At present, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/861A61K48/00A61K45/00A61K39/395A61P35/00
Inventor夏海滨郑晓晶刘世海王东阳冯真真孙晓聪李婧
OwnerSHAANXI NORMAL UNIV