Ad5 D24 conditional reproduction type adenovirus carrier for expressing multiple exogenous genes, constructing method and application thereof
An exogenous gene, ad5d24 technology, applied to conditionally replicating adenovirus vector and its construction scheme and application field, can solve the problems of low tumor tissue infection efficiency, not very obvious therapeutic effect, limited number of expressed therapeutic genes, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Taking the Ad5 D24 conditionally replicable adenoviral vector expressing green fluorescent protein as an example, the construction method steps are as follows:
[0036] 1. Construction of a shuttle vector with 24 base deletions in Ad5E1A molecule CR2
[0037] By designing two pairs of primers, a gene sheet containing 24 base deletions in CR2 of Ad5E1A molecule was obtained through overlapping polymerase chain reaction. P1-P4 are the sequences of two pairs of primers:
[0038] P1: ATTAATTAACATCATCAATAATATACCTTATTTTGGATT;
[0039] P2: TCCTCGTCGTCACTGGGTGGAATCCAAAATAAGGTATATTATTGATGATG;
[0040] P3: CCACCCAGTGACGACGAGGATGAAGAGGGT GAGGAGTTT;
[0041] P4: TACTAGTCCGCTCTCCACAGA TGCATGGCCAG.
[0042] The polymerase chain reaction amplification conditions are: 94°C, 2 minutes, 94°C, 50 seconds, 55°C, 60 seconds, 72°C, 2 minutes, 30 cycles. The overlapping polymerase chain reaction products returned to fragments after electrophoresis with 1.0% agarose. Ligate the PCR fragm...
Embodiment 2
[0052] Taking Ad5 D24 conditionally replicable adenoviral vector expressing small interfering RNA targeting vascular endothelial cell growth factor and Arresten as an example, the construction method steps are as follows:
[0053] 1. Construction of a shuttle vector that deletes 24 bases in CR2 of the Ad5 E1A molecule
[0054] The procedure for constructing the shuttle vector with 24 bases deleted in CR2 of Ad5 E1A molecule was the same as that in Example 1, and the shuttle vector with 24 bases deleted in CR2 of Ad5 E1A molecule was obtained.
[0055] 2. Construction of the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2
[0056] The construction of the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2 was the same as in Example 1, and the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2 was obtained.
[0057] 3. Construction of adenovirus E4-fiber shuttle vector expressing small interfering RNA target...
Embodiment 3
[0064] Taking the Ad5 D24 conditionally replicable adenoviral vector expressing small interfering RNA (siHecl) targeting cancer highly expressed proteins and tumor necrosis factor-related apoptosis-inducing ligand (Trail) as an example, the construction method steps are as follows:
[0065] 1. Construction of a shuttle vector with 24 base deletions in Ad5 E1A molecule CR2
[0066] The procedure for constructing the shuttle vector with 24 bases deleted in CR2 of Ad5 E1A molecule was the same as that in Example 1, and the shuttle vector with 24 bases deleted in CR2 of Ad5 E1A molecule was obtained.
[0067] 2. Construction of the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2
[0068] The construction of the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2 was the same as in Example 1, and the adenoviral vector backbone with 24 base deletions in Ad5 E1A molecule CR2 was obtained.
[0069] 3. Construction of an adenovirus E4-fi...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap