Exonuclease III/I protection analysis based fluorescent biosensor method for detecting single nucleotide polymorphism

A single nucleotide polymorphism and exonuclease technology, applied in biochemical equipment and methods, fluorescence/phosphorescence, material excitation analysis, etc., can solve the problem of high analysis cost, achieve fast and easy operation, rapid automation, The effect of small amount of sample

Inactive Publication Date: 2010-05-12
HUNAN UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these techniques usually require the use of special fluorescently labeled probes (such as double labeling), which are expensive to analyze

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Based on exonuclease III / I protection analysis, it is used for mutation detection of β-thalassemia 654 site

[0020] 1) Allele-specific extension of a single deoxynucleotide labeled with biotin: the total volume of the base extension reaction is 25 L, and it is carried out in four different PCR tubes, wherein each tube includes the target strand to be detected, 5pmol of hairpin oligonucleotide probe primers, the primer sequence is GAA TTC CAA GCG CGA AG TTTT CTT CGC GCT TGG AAT TC TTTTTTCAC CAT TCT AAA GAA TAA CAG TGA TAA TTT CTG GGT TAA GG, 50pmol of four kinds of Biotin- A base of dNTP (Invitrogen), 2unit Taq DNA polymerase (NEB), 1×Tap DNA polymerase standard buffer solution (10mM Tris-HCL (pH 8.6), 50mM KCL, 1.5mM MgCL 2 ), the reaction was carried out in a 200μL PCR tube, denatured at 94°C for 3min, denatured at 94°C for 30s, annealed at 62°C for 30s, and extended at 68°C for 10s, for a total of 20 cycles, and finally stayed at 4°C. The product after ext...

Embodiment 2

[0024] Embodiment 2: Based on exonuclease III / I protection analysis, it is used for the mutation detection of the 12th codon of K-ras gene

[0025] 1) Allele-specific extension of a single deoxynucleotide labeled with biotin: the total volume of the base extension reaction is 25 L, and it is carried out in four different PCR tubes, wherein each tube includes the target strand to be detected, The hairpin oligonucleotide probe primer of 5pmol, primer sequence is (GAA TTC CAA GCG CGA AG TTTT CTT CGC GCT TGG AAT TCTTTTTTGAATAAACTTGTGGTAGTTGGAGCTG), a kind of base of four kinds of Biotin-dNTP (Invitrogen) of 50pmol, 2unit Taq DNA polymerase (NEB), 1×Tap DNA polymerase standard buffer solution (10mM Tris-HCL (pH 8.6), 50mM KCL, 1.5mM MgCL 2 ), the reaction was carried out in a 200 μL PCR tube, denatured at 94°C for 3 min, denatured at 94°C for 30 s, annealed at 65°C for 30 s, and extended at 72°C for 10 s, for a total of 20 cycles, and finally stayed at 4°C. The extended product wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an exonuclease protection analysis based fluorescent biosensor method for detecting single nucleotide polymorphism, which comprises allele-specific extension of micromolecule modified single nucleotide, interaction between an oligonucleotide DNA strand primer with micromolecules after extension and binding protein, protection analysis of the exonuclease III / I and fluorescent quantitative detection of a hairpin type oligonucleotide DNA probe primer subjected to end protection based on double-strand indicating dye. The method adopts allele-specific extension of the primer to combine the micromolecule modified single nucleotide at 3' end of a specific primer and then combine the specificity of the binding protein of the micromolecule to protect the primer from being degraded by the exonuclease III / I, and detects single nucleotide polymorphism genotyping through fluorescence of the complex of the protected oligonucleotide DNA primer and double-strand inserting dye. The method features simple and convenient operation, economy, fast speed, sensitivity and strong specificity and is expected to provide a universal technology platform for screening and prenatal diagnosis of the population suffering from gene mutation related genetic diseases.

Description

technical field [0001] The invention belongs to a biosensing method for detecting single nucleotide polymorphism, which includes a single deoxynucleotide allele-specific extension technology modified by small molecules, and oligonucleotide DNA chain primers with small molecules after extension Interaction with binding proteins and protection analysis of exonuclease III / I and fluorescence quantitative detection of double-stranded structure oligonucleotide DNA strands with terminal protection based on double-stranded indicator dyes. Background technique [0002] Many human genetic diseases such as α and β thalassemia are caused by single gene mutations. These genetic diseases are one of the most important birth defects in my country, seriously affecting the population quality of our country, and bringing heavy economic burdens to society and families. Therefore, it is necessary to establish a rapid, sensitive and specific detection technology. Traditional gene mutation detect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/44G01N21/64
Inventor蒋健晖吴战楚霞沈国励俞汝勤
OwnerHUNAN UNIV