Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI

A technology of restriction endonucleases and binding proteins, which is applied in the field of fluorescent biosensing based on restriction enzyme FokI inhibition analysis to detect the interaction between small molecules and binding proteins, can solve the problem of low sensitivity and poor reliability of detection techniques, It cannot meet the problems of accurate and rapid detection, and achieves the effect of quick and easy operation and simple design

Inactive Publication Date: 2010-06-02
HUNAN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These detection techniques have low sensitivity, poor reliability, and require sophisticated instruments, which cannot meet the needs of accurate and rapid detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Detection of Biotin Based on Restriction Enzyme FokI Inhibition Assay

[0025] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA strands and biotin

[0026] Weigh 6.1mg of biotin and dissolve in 2.5mL phosphate buffer solution (0.1M NaH 2 PO4, pH 7.4), then add 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15min, then add 2.8mg of N-hydroxysuccinyl Imine (NHS), react at room temperature for 30min. Take 260 μl of the activated biotin solution and add it to 260 μl of 10 μM intermediate amino-labeled oligonucleotide DNA single strand (GAACAACAACCAACATCCAAACTTCTATATGGATGAAT(NH2)CAAC) solution, and react at room temperature for 2 h under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.

[0027] Transfer the cross-linked reaction product to a 1 mL dialysis tube with a molecular weight cut-off of 6000D. Put the dialysi...

Embodiment 2

[0030] Example 2: Detection of folate-binding proteins based on restriction enzyme inhibition assays

[0031] 1) Cross-linking of intermediate amino-labeled oligonucleotide DNA single strands and folic acid

[0032]Weigh 10mg of folic acid and dissolve in 2.5mL phosphate buffer solution (0.1M NaH 2 PO4, pH 7.4), then add 1mg of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), stir at room temperature for 15min, then add 2.8mg of N-hydroxysuccinate Imide (NHS), react 30mm at room temperature. Take 260 μl of the activated folic acid solution and add it to 260 μl of 10 μM intermediate amino-labeled oligonucleotide DNA single strand (GAACAACAACCAACATCCAAACTTCTATATGGATGAAT(NH2)CAAC) solution, and react at room temperature for 2 hours under gentle stirring. After the reaction, 3.6 mg of hydroxylamine hydrochloride was added to the mixed solution to terminate the reaction.

[0033] Transfer the cross-linked reaction product to a 1 mL dialysis tube with a molecular weight cut-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fluorescent biosensing method for inhibiting and analyzing and detecting interaction between micromolecules and binding protein based on restrictive incision enzyme FokI, which comprises an interaction between an oligonucleotides DNA chain which is modified by organic micromolecules and a protein, formation conditions for the restrictive incision enzyme FokI dipolymer and selection of inhibition locus, and real-time fluorescence quantitative detecting technology based on a Taqman probe. By utilizing specificity combination of the micromolecules modifying among the oligonucleotides DNA chain and the binding protein thereof or antibodies, the interaction between the micromolecules and the protein and the micromolecules or the binding protein thereof can be detected through a real-time quantitative analysis on enzyme incision Taqman probe fluorescence based on the inhibition effect on the incision of the restrictive incision enzyme FokI by the interaction between the micromolecules and the proteins or the antibodies. The method has the advantages of high sensitivity, simple and convenient operation, and high specificity, and can be used for study on signal transduction and molecular regulation mechanism in biomedicine, safety detection of foods and agricultural products, detection on environmental toxicant, medicine screening and the like.

Description

technical field [0001] The invention belongs to a biosensing technology for detecting the interaction between organic small molecules and binding proteins, which specifically refers to the conditions for the formation of restriction endonuclease FokI dimers and the selection of inhibitory sites, and the oligonucleus of intermediate modified organic small molecules Interaction between nucleotide DNA chain and protein, restriction endonuclease FokI inhibition analysis, and real-time fluorescence quantitative detection method based on Taqman probe. Background technique [0002] The rapid screening and detection of small organic molecules such as interactions between organic small molecules and binding proteins, drugs and chemical toxins, and small molecule binding proteins are extremely important for clinical diagnosis, medical research, food and public safety, drug screening, environmental monitoring and other fields. meaning. At present, the commonly used detection technique...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/44G01N21/64
Inventor 蒋健晖甄珍楚霞沈国励俞汝勤
Owner HUNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com