Recombinant expression of human TIM-1-Fc fusion protein
A fusion protein, human immunoglobulin technology, applied in the field of recombinant expression of TIM-1Fc, can solve the problems of affecting protein activity, unable to meet the activity, and low product recovery rate.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Example 1 Artificial synthesis of Tim-1 gene
[0063] According to the human Tim-1 gene sequence searched in the gene bank, the human Tim-1 gene was artificially synthesized, and the mouse IgK secretion signal was added to its N-terminus (5' end), according to the degeneracy of codons Eliminate the enzyme cutting site used in this experiment; the synthesized Tim-1 was subcloned into the mammalian cell expression vector pcDNA3.1 vector, and the vector plasmid pcDNA3.1-Tim containing the Tim-1 gene was amplified and extracted -1.
[0064] The sequence of the mouse IgK secretion signal-Tim-1 is as follows (SEQ ID NO: 1; the underlined part in italics indicates the mouse IgK secretion signal):
[0065] TCTGTAAAGGTTGGTGGAGAGGCAGGTCCATCTGTCACACTACCCTGCCACTACAGTGGAGCTGTCACATCCATGTGCTGGAATAGAGGCTCATGTTCTCTATTCACATGCCAAAATGGCATTGTCTGGACCAATGGAACCCACGTCACCTATCGGAAGGACACACGCTATAAGCTATTGGGGGACCTTTCAAGAAGGGATGTCTCTTTGACCATAGAAAATACAGCTGTGTCTGACAGTGGCGTATATTGTTGCCGTGTTGAGCACCGTG...
Embodiment 2
[0066] Example 2 Construction of pcDNA3.1-Tim-1-Fc expression vector
[0067] The Fc fragment (hinge-CH2-CH3) of human IgG1 was fished from the human cDNA library, and the human Fc fragment (hinge-CH2-CH3) was cloned into pcDNA3.1-Tim-1, and the accuracy of the constructed plasmid was verified by sequencing; Extract the kit, and extract the recombinant plasmid DNA, pcDNA3.1-Tim-1-Fc, according to the instructions.
[0068] The Fc fragment sequence of human IgG1 is as follows (SEQ ID NO: 4):
[0069]GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGG...
Embodiment 3
[0070] Example 3 Obtaining of recombinant Tim-1-Fc protein
[0071] 1. Induced expression
[0072] The sequenced correct pcDNA3.1-Tim-1-Fc was used Lipofectamine TM -2000 was transfected into CHO cells with a fusion rate of 75-85%. After culturing for 48 hours, the cells and their supernatant were collected. Detect the results of each step and control the quality of the final product by SDS-PAGE electrophoresis. Verify the correctness of the target protein by Western-blot ( figure 1 ).
[0073] 2. Protein purification
[0074] According to the above-mentioned optimal conditions for fusion protein expression, expand the culture volume, collect the supernatant, and purify the expressed recombinant protein Tim-1-Fc through various chromatography methods such as affinity, ion exchange, hydrophobicity and gel filtration. The final protein The purity of the product is generally not less than 80%. Detect the results of each step and control the quality of the final product by S...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 