Recombinant expression of human TIM-1-Fc fusion protein

A fusion protein, human immunoglobulin technology, applied in the field of recombinant expression of TIM-1Fc, can solve the problems of affecting protein activity, unable to meet the activity, and low product recovery rate.

Active Publication Date: 2010-08-11
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, an important disadvantage of using Escherichia coli to produce biologically active proteins, especially eukaryotic proteins, is that the expression products form so-called inclusion bodies in the host cytoplasm, that is, insoluble polymers without biological activity. Denaturation-dissolution-renaturation treatment
The recovery rate of the product obtained in this process is very low, which also affects the activity of the protein; in addition, prokaryotic expression systems such as Escherichia coli have no protein glycosylation function, and cannot meet the activity obtained by protein glycosylation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression of human TIM-1-Fc fusion protein
  • Recombinant expression of human TIM-1-Fc fusion protein
  • Recombinant expression of human TIM-1-Fc fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Artificial synthesis of Tim-1 gene

[0063] According to the human Tim-1 gene sequence searched in the gene bank, the human Tim-1 gene was artificially synthesized, and the mouse IgK secretion signal was added to its N-terminus (5' end), according to the degeneracy of codons Eliminate the enzyme cutting site used in this experiment; the synthesized Tim-1 was subcloned into the mammalian cell expression vector pcDNA3.1 vector, and the vector plasmid pcDNA3.1-Tim containing the Tim-1 gene was amplified and extracted -1.

[0064] The sequence of the mouse IgK secretion signal-Tim-1 is as follows (SEQ ID NO: 1; the underlined part in italics indicates the mouse IgK secretion signal):

[0065] TCTGTAAAGGTTGGTGGAGAGGCAGGTCCATCTGTCACACTACCCTGCCACTACAGTGGAGCTGTCACATCCATGTGCTGGAATAGAGGCTCATGTTCTCTATTCACATGCCAAAATGGCATTGTCTGGACCAATGGAACCCACGTCACCTATCGGAAGGACACACGCTATAAGCTATTGGGGGACCTTTCAAGAAGGGATGTCTCTTTGACCATAGAAAATACAGCTGTGTCTGACAGTGGCGTATATTGTTGCCGTGTTGAGCACCGTG...

Embodiment 2

[0066] Example 2 Construction of pcDNA3.1-Tim-1-Fc expression vector

[0067] The Fc fragment (hinge-CH2-CH3) of human IgG1 was fished from the human cDNA library, and the human Fc fragment (hinge-CH2-CH3) was cloned into pcDNA3.1-Tim-1, and the accuracy of the constructed plasmid was verified by sequencing; Extract the kit, and extract the recombinant plasmid DNA, pcDNA3.1-Tim-1-Fc, according to the instructions.

[0068] The Fc fragment sequence of human IgG1 is as follows (SEQ ID NO: 4):

[0069]GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGG...

Embodiment 3

[0070] Example 3 Obtaining of recombinant Tim-1-Fc protein

[0071] 1. Induced expression

[0072] The sequenced correct pcDNA3.1-Tim-1-Fc was used Lipofectamine TM -2000 was transfected into CHO cells with a fusion rate of 75-85%. After culturing for 48 hours, the cells and their supernatant were collected. Detect the results of each step and control the quality of the final product by SDS-PAGE electrophoresis. Verify the correctness of the target protein by Western-blot ( figure 1 ).

[0073] 2. Protein purification

[0074] According to the above-mentioned optimal conditions for fusion protein expression, expand the culture volume, collect the supernatant, and purify the expressed recombinant protein Tim-1-Fc through various chromatography methods such as affinity, ion exchange, hydrophobicity and gel filtration. The final protein The purity of the product is generally not less than 80%. Detect the results of each step and control the quality of the final product by S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fusion protein. The fusion protein comprises human immunoglobulin Fc parts, T cellular immunoglobulin mucoprotein and optional joints. The invention also provides a coding sequence of the fusion protein, an expression vector containing the coding sequence and a host cell. The invention also provides a preparation method of the fusion protein. The fusion protein can be used to inhibit the proliferation of T cells so as to induce immune tolerance.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the recombinant expression of TIM-1 Fc. Background technique [0002] After being activated by antigen, naive CD4+Th cells can differentiate into at least two cell subgroups with different phenotypes and functions: Th1 and Th2 cells. They are the core of immune regulation. The differentiation of Th cells into Th1 and Th2 is regulated by many factors, including antigen types and presentation pathways, APC types, cytokines, transcription factors, signal transduction pathways, and cellular microenvironmental factors. Combined effect. Although much is known about the functions of Th1 and Th2 subsets and the regulation of Th cell differentiation, little is known about the specific surface molecules of the two. In order to find cell surface markers that can distinguish Th1 and Th2, Monney et al. discovered and identified them in 2002. TIM (T cell immunoglobulin mucin, TIM), a new gene fa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N5/10
Inventor王全兴丁国善刘芳曹雪涛
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY