Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA fragment for inhibiting expression of omega secaline gene in wheat 1B/1R translocation line and application thereof

A technology of gene expression and translocation, applied in the field of plant genetic engineering, can solve the problems of difficult realization of omega-rye alkali gene, poor adaptability, low yield of wheat, etc.

Inactive Publication Date: 2012-09-12
HEBEI ACADEMY OF AGRI & FORESTRY SCI INST OF GENETICS & PHYSIOLOGY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In the quality breeding of wheat 1B / 1R translocation lines as hybrid parents, individuals with 1B / 1R translocation are often eliminated from the hybrid offspring, but this At the same time, the high-yield and wide-fit genes linked to the ω-rye base gene were also eliminated, resulting in high-quality but not high-yield, poor adaptability of the bred wheat
It is difficult to break the linkage between the ω-rye alkali gene and the high-yield and wide-fit genes in conventional wheat breeding, because they are both on the exogenous 1RS chromosome arm, and the 1RS chromosome arm is difficult to integrate with the wheat under normal conditions. 1BS chromosome arms are paired, so it is difficult to solve the problem of high yield and low quality of 1B / 1R translocation wheat by traditional breeding methods
[0004] The ω-ryeline gene is a gene family including multiple members, and the DNA sequences of different family members are highly similar (Chai et al., Cell Research, 2005, 15(8):658-664). The omega-ryeline gene is feasible, but it is difficult to mutate multiple omega-ryeline genes at the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA fragment for inhibiting expression of omega secaline gene in wheat 1B/1R translocation line and application thereof
  • DNA fragment for inhibiting expression of omega secaline gene in wheat 1B/1R translocation line and application thereof
  • DNA fragment for inhibiting expression of omega secaline gene in wheat 1B/1R translocation line and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Preparation of DNA fragments for silencing ω-ryeline gene

[0028] According to the sequences of the coding regions of different members of the omega-ryeline gene published in the journal Cell Research (Chai et al., Cell Research, 2005, 15(8):658-664), select a relatively conserved segment at 5′ to design a pair of primers , P3-1: ttcccgggccttcctcatctttgtcct (the part in bold is the added Sma I restriction sequence), P4-1: taggatccgctctggtctctggggttg (the part in bold is the added BamH I restriction site), based on the genome of wheat 1B / 1R translocation line Lankao 906 DNA was used as a template for PCR amplification, and the amplification parameters were: 94°C for 4 minutes, 94°C for 45 seconds, 65°C for 45 seconds, 72°C for 1 minute, 30 cycles, and 72°C for 7 minutes. The PCR amplification products were cloned with the pBS-T cloning kit of Tiangen Biochemical Technology (Beijing) Co., Ltd., and some positive clones were selected for sequencing. One of the...

Embodiment 2

[0032] Embodiment 2: Construction of RNAi genetic expression vector

[0033] The GUS gene was excised from the basic plant binary expression vector pAHC25 (Christensen AH and Quail PH, Transgenic Research, 1996, 5:213-218) with Sma I / Sac I double enzyme digestion, and then connected to the same double enzyme digestion from the recombinant The fragment of SEQ ID NO.1 excised from the vector pBS-T-Sec was used to obtain a new recombinant expression vector pAHC25-Sec. The promoter used in this expression vector is maize Ubiquitin, and the plant resistance screening gene is BAR gene, which can be used directly Genetic transformation mediated by gene gun or pollen tube.

Embodiment 3

[0034] Embodiment 3: Construction of RNAi genetic expression vector

[0035] The GUS gene was excised from the basic plant binary expression vector pAHC15 (Christensen AH and Quail PH, Transgenic Research, 1996, 5:213-218) with Sma I / Sac I double enzyme digestion, and then connected to the same double enzyme digestion from the recombinant The fragment of SEQ ID NO.1 excised from the vector pBS-T-Sec was used to obtain a new recombinant expression vector pAHC15-Sec. The promoter used in this expression vector was maize Ubiquitin, which did not contain a plant resistance screening gene and could be used with plants containing The expression vector pAHC20 (Christensen AH and Quail PH, Transgenic Research, 1996, 5:213-218) of the resistance screening marker BAR gene was used for gene gun co-transformation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a DNA fragment for inhibiting the expression of an omega secaline gene in a wheat 1B / 1R translocation line and application thereof. The DNA fragment consists of an omega secaline gene coding region partial sequence, a plant intron sequence and the inverted repeat sequence of the omega secaline gene coding region partial sequence which are connected in turn. An RNAi geneticexpression vector containing the DNA fragment is transferred to the wheat 1B / 1R translocation line in a transgenic way, so that the expression of the endogenous omega secaline gene can be inhibited, the adverse effects of omega secaline on the food processing quality of the wheat 1B / 1R translocation line are relieved or eliminated and the food processing quality of the wheat 1B / 1R translocation line is improved.

Description

technical field [0001] The invention relates to a DNA fragment for inhibiting the expression of omega-rye alkali gene in wheat 1B / 1R translocation line in the field of plant genetic engineering and its application in improving the processing quality of 1B / 1R translocation line wheat. Background technique [0002] Due to the advantages of high yield and wide adaptability, the 1B / 1R translocation line of wheat occupies a large share in the high-yield wheat widely promoted in my country. However, such varieties generally have poor processing quality, mainly reflected in low gluten strength, poor kneading resistance and sticky dough, which have obvious adverse effects on the processing quality of bread and noodles (Dhaliwal et al., Cereal Sci., 1990, 12 :165-175; Liu Jianjun et al., Acta Crops Sinica, 2004, 30(2):149~153). Studies have found that the ω-ryeline gene on the 1RS chromosome arm of the wheat 1B / 1R translocation line is considered to be an important reason for the po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/63A01H4/00A01H5/00
Inventor 柴建芳杨帆王海波
Owner HEBEI ACADEMY OF AGRI & FORESTRY SCI INST OF GENETICS & PHYSIOLOGY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More