Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Loop-mediated isothermal amplication technology-based quick campylobacter jejunii detection kit and using method thereof

A technology for Campylobacter jejuni and detection kits, which are applied in the directions of microorganism-based methods, microbial determination/inspection, biochemical equipment and methods, etc., can solve problems such as methods and detection kits for which Campylobacter jejuni is not seen, To achieve the effect of short reaction time, strong specificity and high sensitivity

Inactive Publication Date: 2011-07-13
JIANGSU INST OF POULTRY SCI +2
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Loop-mediated isothermal amplification technology has many advantages in pathogenic nucleic acid detection technology, but there is no method and detection kit for using loop-mediated isothermal amplification technology to detect Campylobacter jejuni

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] The present invention adopts following technical scheme:

[0079] The present invention is made up of (1) reaction solution; (2) primer set; (3) sample pretreatment liquid; (4) positive control solution, and described primer set comprises two pairs of specific primers, i.e. internal primers and external primers, respectively as follows:

[0080] The primer sequences are as follows:

[0081] inner primer 1

[0082] TGTGCCTACTTTTTATATTTCTCATCTTTTTCCTCAATCTCGCTTTGGGA

[0083] Inner primer 2:

[0084] CACGGAAAAAGTATCAATCTGAATTTTGCCTAAGATGACATTTCTATCAACA

[0085] Outer primer 1: ACAAAATTTCAGCCTTTGGT

[0086] Outer primer 2: CCTTGAGCACGTTCTTTG

[0087] Preferably, the reaction solution is composed of Tris-HCl (pH 8.8) with a concentration of 100mM, KCl with a concentration of 50mM, and (NH4) with a concentration of 50mM. 2 Composition of SO4, Bst DNA polymerase with a concentration of 1.6U, betaine with a concentration of 4M, dNTP with a concentration of 6mM-8mM, MgSO4...

Embodiment 2

[0097] The present invention adopts following technical scheme:

[0098] The present invention is made up of (1) reaction solution; (2) primer set; (3) sample pretreatment liquid; (4) positive control solution, and described primer set comprises two pairs of specific primers, i.e. internal primers and external primers, respectively as follows:

[0099] The primer sequences are as follows:

[0100] Inner primer 1:

[0101] TCCGTGTGTGCCTACTTTTATTTTATTCACGATGTTTTAGGGATTAACG

[0102] Inner primer 2:

[0103] TGTTGATAGAAATGTCATTCTTAGGCTTTTCGACAAGTGCATTATCGAGTA

[0104] Outer primer 1: CAGCCTTTGGTCCTCAA

[0105] Outer primer 2: TTTGCGCTGCTTTGGTT

[0106] Preferably, the reaction solution is composed of Tris-HCl (pH 8.8) with a concentration of 100mM, KCl with a concentration of 50mM, and (NH4) with a concentration of 50mM. 2 Composition of SO4, Bst DNA polymerase with a concentration of 1.6U, betaine with a concentration of 4M, dNTP with a concentration of 6mM-8mM, MgSO4 with...

Embodiment 3

[0116] The present invention adopts following technical scheme:

[0117] The present invention is made up of (1) reaction solution; (2) primer set; (3) sample pretreatment liquid; (4) positive control solution, and described primer set comprises two pairs of specific primers, i.e. internal primers and external primers, respectively as follows:

[0118] The primer sequences are as follows:

[0119] Inner primer 1:

[0120] TGTGCCTACTTTTTATATTTCTCATCTTTTTGCTTTGGGATTATTCACGAT

[0121] Inner primer 2:

[0122] CACGGAAAAAGTATCAATCTGAATTTTGCCTAAGATGACATTTCTATCAACA

[0123] Outer primer 1: CAGCCTTTGGTCCTCAA

[0124] Outer primer 2: CATTATCGAGTATGCCTTGAG

[0125] Preferably, the reaction solution is composed of Tris-HCl (pH 8.8) with a concentration of 100mM, KCl with a concentration of 50mM, and (NH4) with a concentration of 50mM. 2 Composition of SO4, Bst DNA polymerase with a concentration of 1.6U, betaine with a concentration of 4M, dNTP with a concentration of 6mM-8mM, MgS...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a loop-mediated isothermal amplication technology-based quick campylobacter jejunii detection kit and a using method thereof. The kit consists of (1) reaction solution, (2) a primer group, (3) sample pretreatment solution and (4) positive contrast solution, wherein the primer group is one of the following eight primer groups, and each primer group comprises a pair of primers, namely an internal primer and an external primer; and a calcein manganese complex is added in advance in the reaction, the manganese is combined with pyrophosphate radical ions separated by dNTP to release the calcein, the released calcein can be observed and identified by naked eyes, the positive result is yellow green, and the negative result is light yellow. The kit has the advantages of strong specificity, short reaction time, high sensitivity and the like.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a detection kit for detecting Campylobacter jejuni in a sample by a loop-mediated isothermal amplification technique and a method for using the detection kit. Background technique [0002] Campylobacter jejuni is a member of the genus Campylobacter, which is a Gram-negative bacterium. It is a zoonotic pathogen that has been widely valued at home and abroad in recent years. Barre syndrome. The bacteria can enter the environment through the feces of infected animals or patients, and enter a dormant period called "viable but noncultureable (VBNC) state in the water environment. It can be resuscitated and has pathogenicity. Contact with infected animals, or ingestion of contaminated poultry products, water and milk are the main ways for the bacteria to infect humans. [0003] Due to the harsh culture conditions of Campylobacter jejuni, it does not grow at 25°C and grows well at 42°...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12R1/01
Inventor 高玉时唐梦君周生张小燕蒲俊华葛庆联唐修君施祖灏吴敏
Owner JIANGSU INST OF POULTRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com