Loop-mediated isothermal amplication technology-based quick campylobacter jejunii detection kit and using method thereof
A technology for Campylobacter jejuni and detection kits, which are applied in the directions of microorganism-based methods, microbial determination/inspection, biochemical equipment and methods, etc., can solve problems such as methods and detection kits for which Campylobacter jejuni is not seen, To achieve the effect of short reaction time, strong specificity and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0078] The present invention adopts following technical scheme:
[0079] The present invention is made up of (1) reaction solution; (2) primer set; (3) sample pretreatment liquid; (4) positive control solution, and described primer set comprises two pairs of specific primers, i.e. internal primers and external primers, respectively as follows:
[0080] The primer sequences are as follows:
[0081] inner primer 1
[0082] TGTGCCTACTTTTTATATTTCTCATCTTTTTCCTCAATCTCGCTTTGGGA
[0083] Inner primer 2:
[0084] CACGGAAAAAGTATCAATCTGAATTTTGCCTAAGATGACATTTCTATCAACA
[0085] Outer primer 1: ACAAAATTTCAGCCTTTGGT
[0086] Outer primer 2: CCTTGAGCACGTTCTTTG
[0087] Preferably, the reaction solution is composed of Tris-HCl (pH 8.8) with a concentration of 100mM, KCl with a concentration of 50mM, and (NH4) with a concentration of 50mM. 2 Composition of SO4, Bst DNA polymerase with a concentration of 1.6U, betaine with a concentration of 4M, dNTP with a concentration of 6mM-8mM, MgSO4...
Embodiment 2
[0097] The present invention adopts following technical scheme:
[0098] The present invention is made up of (1) reaction solution; (2) primer set; (3) sample pretreatment liquid; (4) positive control solution, and described primer set comprises two pairs of specific primers, i.e. internal primers and external primers, respectively as follows:
[0099] The primer sequences are as follows:
[0100] Inner primer 1:
[0101] TCCGTGTGTGCCTACTTTTATTTTATTCACGATGTTTTAGGGATTAACG
[0102] Inner primer 2:
[0103] TGTTGATAGAAATGTCATTCTTAGGCTTTTCGACAAGTGCATTATCGAGTA
[0104] Outer primer 1: CAGCCTTTGGTCCTCAA
[0105] Outer primer 2: TTTGCGCTGCTTTGGTT
[0106] Preferably, the reaction solution is composed of Tris-HCl (pH 8.8) with a concentration of 100mM, KCl with a concentration of 50mM, and (NH4) with a concentration of 50mM. 2 Composition of SO4, Bst DNA polymerase with a concentration of 1.6U, betaine with a concentration of 4M, dNTP with a concentration of 6mM-8mM, MgSO4 with...
Embodiment 3
[0116] The present invention adopts following technical scheme:
[0117] The present invention is made up of (1) reaction solution; (2) primer set; (3) sample pretreatment liquid; (4) positive control solution, and described primer set comprises two pairs of specific primers, i.e. internal primers and external primers, respectively as follows:
[0118] The primer sequences are as follows:
[0119] Inner primer 1:
[0120] TGTGCCTACTTTTTATATTTCTCATCTTTTTGCTTTGGGATTATTCACGAT
[0121] Inner primer 2:
[0122] CACGGAAAAAGTATCAATCTGAATTTTGCCTAAGATGACATTTCTATCAACA
[0123] Outer primer 1: CAGCCTTTGGTCCTCAA
[0124] Outer primer 2: CATTATCGAGTATGCCTTGAG
[0125] Preferably, the reaction solution is composed of Tris-HCl (pH 8.8) with a concentration of 100mM, KCl with a concentration of 50mM, and (NH4) with a concentration of 50mM. 2 Composition of SO4, Bst DNA polymerase with a concentration of 1.6U, betaine with a concentration of 4M, dNTP with a concentration of 6mM-8mM, MgS...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com