Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof
A technology of recombinant adenovirus and gamma gene, which is applied in genetic engineering, plant genetic improvement, virus/bacteriophage, etc., to achieve the effect of wide host range, convenient operation and good biological safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0062] The first step is to obtain the target gene RARγ:
[0063] Extract the total mRNA of rat MSCs, synthesize cDNA template by reverse transcription, use Primer 5.0 software to design specific full-length primers for RARγ gene, add BamHI restriction site and Kozak sequence to the upstream primer, and add HindⅢ restriction site to the downstream primer , the upstream primer and the downstream primer conform to the nucleotide sequence of SEQ ID2 & SEQ ID3 respectively;
[0064] SEQ ID2 AGAGGATCCACCACCATGGCCACCAATAAGGAG
[0065] SEQ ID3 ATCAAGCTTTCAGGGGCCCTGGTCAGGTTGG
[0066] Use 2×Pfu PCR MasterMix to perform Touch-Down PCR amplification to obtain the target gene RARγ fragment, which conforms to the nucleotide sequence of SEQ ID1;
[0067] Touch-Down PCR parameters: 94°C for 3min, one cycle, 94°C for 30s, 66-56°C for 30s, 72°C for 2min30s, each cycle lowered by 1°C, a total of 10 cycles; 94°C for 30s, 56°C for 30s, 72°C for 2min30s, 24 cycles, 72°C for 5 minutes, one cycl...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com