Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof

A technology of recombinant adenovirus and gamma gene, which is applied in genetic engineering, plant genetic improvement, virus/bacteriophage, etc., to achieve the effect of wide host range, convenient operation and good biological safety

Inactive Publication Date: 2011-08-31
CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the stem cell-derived nature of bone marrow mesenchymal stem cells, it is difficult to achieve gene overexpression by lipofection with general eukaryotic expression plasmids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof
  • Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof
  • Recombinant adenovirus carrying rat retinoic acid receptor (RAR) gamma gene and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0062] The first step is to obtain the target gene RARγ:

[0063] Extract the total mRNA of rat MSCs, synthesize cDNA template by reverse transcription, use Primer 5.0 software to design specific full-length primers for RARγ gene, add BamHI restriction site and Kozak sequence to the upstream primer, and add HindⅢ restriction site to the downstream primer , the upstream primer and the downstream primer conform to the nucleotide sequence of SEQ ID2 & SEQ ID3 respectively;

[0064] SEQ ID2 AGAGGATCCACCACCATGGCCACCAATAAGGAG

[0065] SEQ ID3 ATCAAGCTTTCAGGGGCCCTGGTCAGGTTGG

[0066] Use 2×Pfu PCR MasterMix to perform Touch-Down PCR amplification to obtain the target gene RARγ fragment, which conforms to the nucleotide sequence of SEQ ID1;

[0067] Touch-Down PCR parameters: 94°C for 3min, one cycle, 94°C for 30s, 66-56°C for 30s, 72°C for 2min30s, each cycle lowered by 1°C, a total of 10 cycles; 94°C for 30s, 56°C for 30s, 72°C for 2min30s, 24 cycles, 72°C for 5 minutes, one cycl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant adenovirus carrying a rat retinoic acid receptor (RAR) gamma gene. The gene of the recombinant adenovirus is derived from a rat mesenchymal stem cell and has an SEQID1 sequence. A construction method comprises the following steps: acquiring a target gene RAR gamma; constructing and identifying a recombinant adenovirus plasmid pAd-RAR gamma; and carrying out package, amplification, purification and titer detection on the recombinant adenovirus pAd-RAR gamma in a human embryonic kidney (HEK) 293 cell. In the invention, the rat mesenchymal stem cell can be efficiently infected and the RAR gamma gene can be efficiently expressed, thereby well solving the problem that a general eukaryotic vector is difficultly led in the RAR gamma cell through transfection of liposome; the physical and chemical properties of the used adenovirus vector are stable, thus preparation and operation are easy; the transfection efficiency of the gene is high, and exogenous gene expression level is high; and the obtained adenovirus is replication-defective, is not combined in a gene group of a host cell, has a high biological safety, and is widely suitable for various in vitro cells and in vivo experiment studies.

Description

technical field [0001] The invention relates to a recombinant adenovirus carrying rat retinoic acid receptor γ (Retinoic acid receptor γ, RARγ) gene and its construction method, that is, an important nuclear receptor capable of specifically overexpressing the retinoic acid signal transduction pathway The recombinant adenovirus of RARγ and its construction method, the recombinant adenovirus can efficiently infect mammalian cells, and significantly up-regulate the expression of RARγ transcription and translation levels, thereby providing technical means for in-depth research on the function of RARγ. Background technique [0002] RARs are important nuclear receptors in the whole retinoic acid signal transduction pathway. It has three subtypes, RARα, RARβ, and RARγ. Among them, RARγ has attracted much attention because of its special important function. Studies have shown that the overexpression of RARγ is closely related to the growth and metastasis of hepatocellular carcinoma,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/12C12N15/861C12Q1/68G01N33/53
Inventor 李廷玉龚敏毕杨陈洁张赟江伟魏小平喻琴
Owner CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com