Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rhodococcus rhodochrous for expressing mpd genes and construction method thereof

A rhodococcus rhodococcus, construction method technology, applied in the fields of environmental bioengineering and genetic engineering, can solve problems such as pollution bioremediation

Inactive Publication Date: 2011-09-07
ANHUI AGRICULTURAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the problem of bioremediation of pesticide pollution, the present invention provides a biological material and a construction method, that is, a Rhodococcus rhodococcus expressing the mpd gene for degrading chlorpyrifos and a construction method thereof

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0138] Rhodococcus rhodococcus R-D3 expressing the mpd gene ( Rhodococcus rhodochrousR-D3)的基因序列如下:ATGCCCCTGAAGAACCGCTTGCTGGCCCGCCTGTCCTGTGTTGCGGCCGTGGTGGCCGCCACGGCCGCCGTTGCACCGTTGACGCTGGTGTCCACCGCCCACGCCGCCGCACCGCAGGTGCGCACCTCGGCCCCCGGCTACTACCGGATGCTGCTGGGCGACTTCGAAATCACCGCGCTGTCGGACGGCACGGTGGCGCTGCCGGTCGACAAGCGGCTGAACCAGCCGGCCCCGAAGACGCAGAGCGCGCTGGCCAAGTCCTTCCAGAAAGCGCCGCTCGAAACCTCGGTCACCGGTTACCTCGTCAACACCGGCTCCAAGCTGGTGCTGGTGGACACCGGCGCGGCCGGCCTGTTCGGCCCCACCCTGGGCCGGCTGGCGGCCAACCTCAAGGCCGCAGGCTATCAGCCCGAGCAGGTCGACGAGATCTACATCACCCACATGCACCCCGACCACGTGGGCGGCTTGATGGTGGGTGAGCAACTGGCGTTCCCGAACGCGGTGGTGCGTGCGGACCAGAAAGAAGCCGATTTCTGGCTCAGCCAGACCAACCTCGACAAGGCCCCGGACGACGAGAGCAAAGGCTTCTTCAAAGGCGCCATGGCCTCGCTGAACCCCTATGTGAAGGCCGGCAAGTTCAAGCCTTTCTCGGGGAACACCGACCTGGTGCCCGGCATCAAAGCGCTGGCCAGCCACGGCCACACCCCGGGCCACACCACCTACGTGGTCGAAAGCCAGGGGCAAAAGCTCGCCCTGCTCGGCGACCTGATACTCGTCGCCGCGGTGCAGTTCGACGACCCCAGCGTCACGACCCAGCTCGACAGCGACAGCAAGTCCGTCGCGGTGGAGCGCAAGAAGGCCTTCGCGGATGCCGCCAAGGGCGGCTACCTGATCGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to rhodococcus rhodochrous for expressing mpd genes and a construction method thereof. The rhodococcus rhodochrous R-D3 for expressing the mpd genes can rapidly degrade residues of Dursban (a pesticide) in a water body. The construction method comprises the following steps: 1. extracting the genome DNA of a slightly acidophilic stenotrophomonas G1 bacterial strain; 2. carrying out amplification to obtain the PCR (polymerase chain reaction) product of the G1 bacterial strain; 3.connecting the PCR product of the G1 strain and pET-28a (+), an escherichia coli plasmid and constructing pET-C, a sequencing recombinant plasmid; and 4. constructing pDA71-C, an expressive recombinant plasmid, constructing an electrically transformed rhodococcus rhodochrous R-D3 bacterial strain of pDA71-C, an expressive recombinant plasmid to obtain the rhodococcus rhodochrous R-D3 for expressing the mpd genes.

Description

technical field [0001] The invention belongs to environmental bioengineering and genetic engineering, and specifically relates to the use of molecular biology technology to clone the degrading enzyme gene of the pesticide chlorpyrifos, construct genetic engineering strains, and rapidly degrade the chlorpyrifos polluting the environment. Background technique [0002] my country is a large agricultural country, and the production and usage of pesticides are increasing year by year. The extensive application of pesticides in agricultural production has played an extremely important role in the prevention and control of crop diseases and insect pests, providing a reliable guarantee for a bumper harvest. However, the long-term and large-scale use of pesticides has made the pesticide pollution in the environment more and more serious, endangering people's health, food safety and other environmental problems. Organophosphorus pesticides have been widely and widely used for a long ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/52C12N15/70C12Q1/68C12R1/01
Inventor 花日茂唐欣昀甘旭华高婷婷王道胜
Owner ANHUI AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More