Unlock instant, AI-driven research and patent intelligence for your innovation.

ELISA (enzyme linked immunosorbent assay) kit for detecting pig progenitive and respiratory syndrome (PRRS) antibody

A technology for respiratory syndrome and pig reproduction, applied in the biological field, can solve the problems of unfavorable grass-roots promotion and application, high cost of kit detection, and difficulty in obtaining purified viruses, and achieve low detection cost, easy acquisition and purification, easy determination and The effect of control

Inactive Publication Date: 2011-09-07
BEIJING DABEINONG TECH GRP CO LTD +2
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the virus needs to be proliferated in a large amount in cell culture, it is difficult to obtain the purified virus in the true sense
The detection cost of the kit is too high, and the expensive detection cost makes it difficult for many grassroots units to accept it, making it unfavorable for the promotion and application of the grassroots

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ELISA (enzyme linked immunosorbent assay) kit for detecting pig progenitive and respiratory syndrome (PRRS) antibody
  • ELISA (enzyme linked immunosorbent assay) kit for detecting pig progenitive and respiratory syndrome (PRRS) antibody
  • ELISA (enzyme linked immunosorbent assay) kit for detecting pig progenitive and respiratory syndrome (PRRS) antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 The determination of the reaction conditions of the indirect ELISA method established by the present invention with recombinant GP5 protein as the coated antigen is achieved by the following steps:

[0034] 1. Determination of the optimum coating concentration of antigen and the optimum dilution of serum

[0035] The purified recombinant GP5 protein of PRRSV was serially diluted 1:160 (20 μg / mL), 1:320, 1:640, 1:1280 with the coating solution, and coated on a 96-well microtiter plate, and 100 μL was added to each well. Serum was diluted from 1:25, 1:50 to 1:200 to form a square array, which was operated by ELISA method. The OD450nm value was measured by a spectrophotometer. Select the antigen coating concentration and antibody dilution when the positive serum OD450nm value is around 1 and the positive OD450nm value / negative OD450nm value (ie P / N) ratio is the largest as the optimal working concentration.

[0036] The square array titration results showed tha...

Embodiment 2

[0063] The acquisition of embodiment 2 recombinant GP5 protein

[0064] A pair of primers (upstream primer: TTCGAAT TCAGCAACAACAACAGCTCTCAT; downstream primer: TCGCTCGAGGAGACGACCCCATTG) were designed according to the 32-200th amino acid in the PRRSV GP5 protein to amplify the PRRSV GP5 protein gene sequence (see the sequence listing for the specific sequence), and at its 5′ end and 3 The EcoRI and Xho I restriction sites were introduced into the ' ends, respectively, and cloned into the prokaryotic expression vector pGEX-6p-1 carrying glutathione transferase after the same restriction treatment, the correct expression vector was identified by sequencing, and the It was induced to express, and observed by SDS-PAGE electrophoresis on a 12% polyacrylamide gel. The results are shown in figure 1 . Refer to the GST fusion expression system operation manual for the protein treatment method of large-scale induced expression. The results of SDS-PAGE electrophoresis of the purified GST...

Embodiment 3

[0065] (1) ELISA strip: the recombinant GP5 protein of the porcine reproductive and respiratory syndrome virus GP5 protein gene is used as the coating antigen, and each kit contains 4 pieces of 1% (M / V) BSA (bovine serum albumin) Sealed slats, sealed in packaging bags and stored at 4°C; (2) Washing solution: 1 times concentration of pH 7.4 PBS (phosphate buffer saline) solution; (3) Serum diluent: 1% (M / V) BSA 100 ml; (4) Chromogenic substrate: added H 2 o 2 100 milliliters of TMB (tetramethylbenzidine) solution, wherein every 10 milliliters of solution TMB contains 30% (M / V) concentration H 2 o 2 15 μL; (5) Rabbit anti-pig enzyme-labeled secondary antibody: 100 ml of rabbit anti-pig enzyme-labeled secondary antibody diluted with serum diluent 1% (M / V) BSA to a working concentration of 1:800; (6) Stop solution: 2MH 2 SO 4 Solution 100 ml; (7) Known PRRS positive serum: 5 ml; (8) Known PRRS negative serum: 5 ml.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an ELISA (enzyme linked immunosorbent assay) kit for detecting PRRS antibody and application thereof, belonging to the field of biotechnology. The kit comprises an ELISA slat with recombinant GST-GP5 (glutathione transferase-glycoproteins) protein as coating antigen, a PBS (polydiethylene glycol sebacate) solution, a blood serum diluted solution, a rabbit anti-pig enzyme-labelled bi-antibody, a colour-developing substrate, a terminating liquor, PRRS positive blood serum, PRRS negative blood serum and the like. The kit provided by the invention is used for detecting PRRS antibody; after the indexes like specificity, sensitivity, repeatability and the like of a detection method are inspected, the method is used for detecting serum samples; and the detection coincidence rate with the ELISA kit in the prior art is 90%. The kit provided by the invention has the advantages that the operations are convenient, the repeatability is good, and the kit is suitable for being popularized and applied; a reliable measure for fast detecting PRRSV (pig progenitive and respiratory syndrome virus) antibody is supplied clinically.

Description

technical field [0001] The invention relates to an ELISA kit, in particular to an ELISA kit for detecting porcine reproductive and respiratory syndrome antibodies and an application thereof, belonging to the field of biotechnology. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS) mainly causes reproductive disorders such as premature birth, abortion, stillbirth, mummified fetus and weak piglets in pregnant sows. Piglets and fattening pigs mainly show cough and dyspnea. The disease broke out in the United States for the first time in 1987 (Keffaber K K., 1989), and then spread rapidly throughout the countries and regions with developed swine industry in the world, bringing huge economic losses to the swine industry in the world. The causative agent of this disease is porcine reproductive and respiratory syndrome virus (porcine reproductive and respiratory syndrome virus, PRRSV), which belongs to Arteriviridae (Arteriviridae) member of the nes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/543
Inventor 侯艳红赵亚荣焦连国高福严景华
Owner BEIJING DABEINONG TECH GRP CO LTD