ELISA (enzyme linked immunosorbent assay) kit for detecting pig progenitive and respiratory syndrome (PRRS) antibody
A technology for respiratory syndrome and pig reproduction, applied in the biological field, can solve the problems of unfavorable grass-roots promotion and application, high cost of kit detection, and difficulty in obtaining purified viruses, and achieve low detection cost, easy acquisition and purification, easy determination and The effect of control
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 The determination of the reaction conditions of the indirect ELISA method established by the present invention with recombinant GP5 protein as the coated antigen is achieved by the following steps:
[0034] 1. Determination of the optimum coating concentration of antigen and the optimum dilution of serum
[0035] The purified recombinant GP5 protein of PRRSV was serially diluted 1:160 (20 μg / mL), 1:320, 1:640, 1:1280 with the coating solution, and coated on a 96-well microtiter plate, and 100 μL was added to each well. Serum was diluted from 1:25, 1:50 to 1:200 to form a square array, which was operated by ELISA method. The OD450nm value was measured by a spectrophotometer. Select the antigen coating concentration and antibody dilution when the positive serum OD450nm value is around 1 and the positive OD450nm value / negative OD450nm value (ie P / N) ratio is the largest as the optimal working concentration.
[0036] The square array titration results showed tha...
Embodiment 2
[0063] The acquisition of embodiment 2 recombinant GP5 protein
[0064] A pair of primers (upstream primer: TTCGAAT TCAGCAACAACAACAGCTCTCAT; downstream primer: TCGCTCGAGGAGACGACCCCATTG) were designed according to the 32-200th amino acid in the PRRSV GP5 protein to amplify the PRRSV GP5 protein gene sequence (see the sequence listing for the specific sequence), and at its 5′ end and 3 The EcoRI and Xho I restriction sites were introduced into the ' ends, respectively, and cloned into the prokaryotic expression vector pGEX-6p-1 carrying glutathione transferase after the same restriction treatment, the correct expression vector was identified by sequencing, and the It was induced to express, and observed by SDS-PAGE electrophoresis on a 12% polyacrylamide gel. The results are shown in figure 1 . Refer to the GST fusion expression system operation manual for the protein treatment method of large-scale induced expression. The results of SDS-PAGE electrophoresis of the purified GST...
Embodiment 3
[0065] (1) ELISA strip: the recombinant GP5 protein of the porcine reproductive and respiratory syndrome virus GP5 protein gene is used as the coating antigen, and each kit contains 4 pieces of 1% (M / V) BSA (bovine serum albumin) Sealed slats, sealed in packaging bags and stored at 4°C; (2) Washing solution: 1 times concentration of pH 7.4 PBS (phosphate buffer saline) solution; (3) Serum diluent: 1% (M / V) BSA 100 ml; (4) Chromogenic substrate: added H 2 o 2 100 milliliters of TMB (tetramethylbenzidine) solution, wherein every 10 milliliters of solution TMB contains 30% (M / V) concentration H 2 o 2 15 μL; (5) Rabbit anti-pig enzyme-labeled secondary antibody: 100 ml of rabbit anti-pig enzyme-labeled secondary antibody diluted with serum diluent 1% (M / V) BSA to a working concentration of 1:800; (6) Stop solution: 2MH 2 SO 4 Solution 100 ml; (7) Known PRRS positive serum: 5 ml; (8) Known PRRS negative serum: 5 ml.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 