Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for constructing carrier for producing goat with in vivo synthesis of cysteine transgenes through mediation of piggyBac transposon and application thereof

A construction method, technology of transgenic sheep, applied in the direction of using vectors to introduce foreign genetic material, cells modified by introducing foreign genetic material, recombinant DNA technology, etc.

Inactive Publication Date: 2011-09-14
NORTHWEST A & F UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are no international or domestic reports on transgenic sheep using piggyBac transposon construction vectors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing carrier for producing goat with in vivo synthesis of cysteine transgenes through mediation of piggyBac transposon and application thereof
  • Method for constructing carrier for producing goat with in vivo synthesis of cysteine transgenes through mediation of piggyBac transposon and application thereof
  • Method for constructing carrier for producing goat with in vivo synthesis of cysteine transgenes through mediation of piggyBac transposon and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Construction of pBluSKm-PB vector

[0034] Synthesize a base sequence of the PB5' end and PB3' end necessary for transposition of the piggyBac transposon, and design a sequence with SalI, ClaI, MluI restriction sites between the PB5' end and PB3' end, and at the same time Add a KpnI restriction site at the beginning of PB5', add a SacII restriction site at the end of PB3', and then clone the sequence into the vector pBluSKm to construct a pBluSKm-PB vector.

[0035] The specific sequence is as follows:

[0036] CCCCCC CCCTAGAAAGATAGTCTGCGTAAAATGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACATCTCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAAAATGACGCATGATTATTCTTTTACGTGACTTTTAAGATTTAACTCATACTAGTA

Embodiment 2

[0037] Example 2: Construction of pBluSKm-PB-NEO vector

[0038] Using the pcDNA3.1(+) vector as a template, primers were designed to amplify the Neomycin resistance gene, and SalI and ClaI restriction sites were added to both ends of the primers. The primer sequences are:

[0039] NEO-F CTGTGGAATGTGTGTCAG

[0040] NEO-R CAGACATGATAAGATACATTG

Embodiment 3

[0042] Example 3: Construction of pBluSKm-PB-NEO-EGFP vector

[0043] Using the pEGFP-N1 vector as a template, design primers to amplify the green fluorescent EGFP reporter gene, and add ClaI and MluI restriction sites at both ends of the primers. The primer sequences are:

[0044] EGFP-F TAGTTATTAATAGTAATCAATTAC

[0045] EGFP-R GCAGTGAAAAAAAATGCTTTATT

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a piggyBac transposon carrier for producing a transgenic goat, which mainly comprises the following steps: 1) synthesizing a fragment of base sequence containing a PB5' terminal and a PB3' terminal, which are indispensable when the piggyBac transposon is in transposition, reserving multiple cloning sites between the PB5' terminal and the PB3' terminal during the synthesis, then cloning the sequence into a pBluSKm carrier for constructing a pBluSKm-PB carrier; and further cloning a Neomycin resistance gene and a green fluorescent protein gene into the pBluSKm-PB carrier for finally constructing a pBluSKm-PB-NEO-EGFP transposon carrier. The obtained transposon carrier can meet the requirements on cell screening, micro-operation under an inverted fluorescence microscope, production of the transgenic goat and the like.

Description

technical field [0001] The invention relates to a gene carrier, in particular to a method for constructing a transgenic sheep piggyBac transposon carrier and its application. Background technique [0002] The piggyBac transposon is a type of DNA transposon derived from the Lepidoptera insect, Penicillium moth. It is highly active in mammalian cells and mice. In 2005, Ding Sheng et al. from Fudan University in Shanghai studied piggyBac transposons. A major breakthrough has been made in this regard. Their research results show that piggyBac transposons can efficiently introduce genes and stably express them in human and mouse cells, and have the advantages of large gene carrying capacity and easy operation. They use piggyBac transposons to establish Efficient mouse gene insertion mutagenesis and screening technology has bred hundreds of mouse mutants in less than a year. The research of Ding Sheng et al. from Fudan University has proved that it is possible to use piggyBac tra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/66C12N15/65C12N5/10
Inventor 陈玉林白丁平方堃杨明明何晓琳
Owner NORTHWEST A & F UNIV