Construction method and application of piggyBac transposon vector for producing transgenic goat

A technology of transgenic goat, construction method, applied in the field of gene carrier

Inactive Publication Date: 2011-09-14
NORTHWEST A & F UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are no international or domestic reports on the use of PiggyBac transposons to construct vectors for goat transgenesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of piggyBac transposon vector for producing transgenic goat
  • Construction method and application of piggyBac transposon vector for producing transgenic goat
  • Construction method and application of piggyBac transposon vector for producing transgenic goat

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Construction of pBluSKm-PB vector

[0038] Synthesize a segment of PB5' and PB3' base sequences necessary for the transposition of piggyBac transposon, and design and add BglII, NheI, SalI, ClaI, MluI restriction sites between the PB5' and PB3' ends At the same time, a KpnI restriction site was added at the beginning of PB5', and a SacII restriction site was added at the end of PB3', and then the sequence was cloned into the vector pBluSKm to construct the pBluSKm-PB vector.

[0039] The specific sequence is as follows:

[0040] CCCCCC CCCTAGAAAGATAGTCTGCGTAAAATTGACGCATGCATTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGGACAT C TCAGTCGCCGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCACTGATTTTGAACTATAACGACCGCGTGAGTCAAACGATGACGCATG AT TATCTTTTACGTGACTTTTAAGATTTAACTCATACGATAATTATATTGTTATTTATGTTATTATTCATTGTTATTCATTTATTATT

Embodiment 2

[0041] Example 2: Construction of pBluSKm-PB-PRD vector

[0042] Using goat genomic DNA as a template, the rumen-specific expression promoter PRD-SPRR II primer was designed with reference to the sequence of PRD-SPPRII (accession number: AF279613.1) reported in GenBank, and BamHI and NheI restriction sites were placed on both ends of the primer, The primer sequences are:

[0043] PRD-SPRR II-F TGATTTAAATTAACTTGG

[0044] PRD-SPRR II-R ATGGTGAGGCATCCTTCCTG

[0045] The promoter sequence was amplified by PCR in a 25 μl reaction system. The reaction conditions were pre-denaturation at 95°C for 5 min, 95°C / 30sec, 58°C / 30sec, and 72°C / 3min for 35 cycles, followed by 10min extension at 72°C. The PCR products were double digested with BamHI and NheI, respectively, and the pBluSKm-PB plasmid was double digested with BglII and NheI, respectively. The digested products were recovered and ligated with T4 DNA ligase to construct the pBluSKm-PB-PRD vector.

Embodiment 3

[0046] Example 3: Construction of pBluSKm-PB-PRD-cysEM vector

[0047] Based on the cysE and cysM sequences reported by GenBank (accession number: CP000819), the cysE and cysM sequences were optimized for codon preference (cash goat), and the ribosome binding site IRES sequence was added between the optimized cysE and cysM sequences. , add BGH pola sequence at the end of the optimized cysM sequence, and finally synthesize the sequence. NheI and SalI restriction sites were added to the beginning and end of the synthetic gene sequence, respectively. The synthetic gene cysE-IRES-cysM and pBluSKm-PB-PRD plasmids were digested with NheI and SalI respectively, and the digested products were recovered and ligated with T4 DNA ligase to construct pBluSKm-PB-PRD-cysEM vector.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a piggyBac transposon vector for producing a transgenic goat. The construction method mainly comprises the steps of: (1) synthesizing a section of base sequence comprising a PB5' end and a PB3' end necessary for transposition of a piggyBac transposon, reserving multiple cloning sites in the middle of the PB5' end and the PB3' end during synthesis, and then cloning the sequence into a pBluSKm vector to construct a pBluSKm-PB vector; and then cloning a rumen-specific expression promoter PRD-SPRR II, cysteine synthesis genes cysE and cysM which are subjected to codon preferred optimization, a Neomycin resistant gene and a green fluorescent protein gene to the pBluSKm-PB vector to finally construct a pBluSKm-PB-PRD-cysEM-NEO-EGFP transposon vector. The transposon vector obtained by the invention can meet the requirements of cell screening, micromanipulation under an inverted fluorescence microscope, production of the transgenic goat and the like.

Description

technical field [0001] The invention relates to a gene vector, in particular to a method for constructing a piggyBac transposon vector of a transgenic goat and its application. Background technique [0002] Studies have confirmed that cysteine ​​is the main limiting amino acid for villi growth, and a deficiency in the body will limit villi growth. In goats directly fed cysteine, most of the cysteine ​​is lost by rumen microbes and cannot participate in villi formation. In order to solve this problem, cysteine ​​is usually used to increase villus growth by means of abomasum perfusion or vascular injection (J. Anita. Sci. 1992, 70, 3188-3193). Although this method has certain effects, it is time-consuming and labor-intensive. It requires a certain amount of economic investment, and it is inconvenient for large-scale promotion in production. With the development of biotechnology, studies have found that the genes cysE (serine acetyltransferase gene) and cysM (O-acetylserine h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/66C12N15/85A01K67/027
Inventor陈玉林白丁平方堃杨明明何晓琳
OwnerNORTHWEST A & F UNIV