Recombinant EDI (Endothelial Genesis Inhibitor)-8t protein with endothelial cell growth inhibiting activity
An endothelial growth and inhibitory protein technology, applied in the field of genetic engineering drugs, can solve the problem of limited inhibitory effect on endothelial cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Embodiment 1, the acquisition of gene sequence
[0087] SEQ ID NO: 1 and SEQ ID NO: 2 show the gene and protein sequence of EDI-8t protein. Take fresh human umbilical cord, use Trizol reagent to extract total RNA, dissolve it in RNase-inactivated sterile double-distilled water, use this as a template, and use Tiangen Company’s reverse transcription kit for RT-PCR, according to the kit instructions operate. Then with the obtained reverse transcription product as a template, primer 1 (sequence is ATCG CTCGAGAAAAGAGAGGCTGAAGCTGGCAAGAATGGAGGGCCA (SEQ ID NO: 4), wherein the underlined part is the introduced XhoI cutting point) and primer 2 (the sequence is ATC GAATTC ATTA GTGATGGTGATGGTGATG CATGGGATACAATAAATA (SEQ ID NO: 5), where the underlined part is the introduced EcoRI cleavage point) is used as the upstream and downstream primers for PCR, and the PCR product with XhoI and EcoRI restriction sites at both ends is obtained. The DNA electrophoresis verification resul...
Embodiment 2
[0090] Embodiment 2, expression of gene in Pichia pastoris
[0091] Extract the above-mentioned recombinant plasmid pPIC-EDI-8t, digest it with BglII (Takara) and extract it, then electrotransform Pichia pastoris expression strain GS115 (purchased from Invitrogen Company), spread the transformed product on an MD plate, and incubate at 30°C for 3- 5 days.
[0092] The recombinant expression strain was identified by PCR method, and the recombinant expression strain Gp-EDI-8t was obtained by shaking flask screening after obtaining positive clones.
[0093] After the expression strain was fermented and cultured, the electrophoresis of the supernatant was as follows: figure 2 shown.
Embodiment 3
[0094] Embodiment 3, recombinant protein purification
[0095] Centrifuge the fermentation broth, perform ultrafiltration, nickel column affinity chromatography under alkaline conditions, anion exchange, and gel filtration, and finally obtain the target protein with a 6×His Tag tag at the carboxyl terminal. The electrophoresis verification results are as follows: image 3 shown.
[0096] According to the results of electrophoresis and Western blot, it was speculated that the target protein contained some dimer forms.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com