Method for knocking out target gene of Chlamydomonas reinhardtii
A technology of target gene, Chlamydomonas reinhardtii, which is applied in the field of silencing the target gene of Chlamydomonas reinhardtii, can solve the problems of unfavorable research work and achieve the effect of good economy, easy operation and high enzyme digestion efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0052] Knockout of Chlamydomonas reinhardtii rsep1 (Protein ID: 206032) gene.
[0053] 1. Design forward and reverse primers:
[0054] RSEP1-347BP-3UCS-F: GTCGCGGCTTGTTTTACAAT
[0055] RSEP1-347BP-3UCS-R: CCTCCTGTTATTTTCCCAGCA
[0056] Using Chlamydomonas reinhardtii CC124 cDNA as a template, a 347bp nucleotide fragment of its 3' non-coding region was amplified. The fragment was recovered and inserted into the pMD-18T vector of Takara Company. After the recombinant vector was sequenced, the sequence comparison software provided by NCBI was used for sequence comparison, and it was determined that the cloned DNA fragment was a 347 bp nucleotide fragment in the 3' non-coding region of the rsep1 gene. The cloning vector pMD-RSEP1 of this fragment was obtained.
[0057] 2. Digest pMD-RSEP1 with HindIII and XbaI. The 347 bp fragment of the 3' non-coding region of the rsep1 gene is recovered and inserted into the intermediate vector pMD285 that has been digested with HindIII and ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap