Method for knocking out target gene of Chlamydomonas reinhardtii

A technology of target gene, Chlamydomonas reinhardtii, which is applied in the field of silencing the target gene of Chlamydomonas reinhardtii, can solve the problems of unfavorable research work and achieve the effect of good economy, easy operation and high enzyme digestion efficiency

Inactive Publication Date: 2011-11-02
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This is very bad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out target gene of Chlamydomonas reinhardtii
  • Method for knocking out target gene of Chlamydomonas reinhardtii
  • Method for knocking out target gene of Chlamydomonas reinhardtii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0052] Knockout of Chlamydomonas reinhardtii rsep1 (Protein ID: 206032) gene.

[0053] 1. Design forward and reverse primers:

[0054] RSEP1-347BP-3UCS-F: GTCGCGGCTTGTTTTACAAT

[0055] RSEP1-347BP-3UCS-R: CCTCCTGTTATTTTCCCAGCA

[0056] Using Chlamydomonas reinhardtii CC124 cDNA as a template, a 347bp nucleotide fragment of its 3' non-coding region was amplified. The fragment was recovered and inserted into the pMD-18T vector of Takara Company. After the recombinant vector was sequenced, the sequence comparison software provided by NCBI was used for sequence comparison, and it was determined that the cloned DNA fragment was a 347 bp nucleotide fragment in the 3' non-coding region of the rsep1 gene. The cloning vector pMD-RSEP1 of this fragment was obtained.

[0057] 2. Digest pMD-RSEP1 with HindIII and XbaI. The 347 bp fragment of the 3' non-coding region of the rsep1 gene is recovered and inserted into the intermediate vector pMD285 that has been digested with HindIII and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of bioengineering and in particular relates to a method for knocking out a target gene of Chlamydomonas reinhardtii. The method comprises the following step of constructing a vector pMCS-SPA-MCS and a vector pTSBIR-XIR. According to the invention, the purpose of silencing the target gene of Chlamydomonas reinhardtii is achieved by screening a transformant which exerts a silencing effect on the candidate gene, utilizing the restriction enzyme cutting sites of the vector pMCS-SPA-MCS and constructing a vector pXF-SPA-XR to construct the vector pTSBIR-XIR for the target gene RNAi. The method has the characteristics of increasing the efficiency of knocking out the target gene and being convenient to operate and rapid.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a knockout method for rapidly, accurately and efficiently silencing target genes of Chlamydomonas reinhardtii by using an intermediate carrier. Background technique [0002] Chlamydomonas reinhardtii belongs to Chlorophyta, Volvox, and Chlamydomonaceae. It is a single-celled eukaryotic flagellate algae. ) model organisms, have many common characteristics with yeast cells, such as simple growth cycle, fast growth, short generation time, can form single clones on the plate, and can also be cultured in liquid, with two types of haploid and diploid Form growth, can carry out tetramolecular analysis on the development process of its gametes, etc. Therefore, it is called "photosynthetic yeast". It has a clear genetic background and is currently the only biological material that has established three sets of genetic transformation systems for nucleus, chloroplast an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/63C12N15/113C12N15/66
Inventor 邓晓东费小雯
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap