Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of pprM gene of Deinococcus radiodurans R1 in improvement of drought-resistant traits of plants

A gene and plant technology, applied in the field of new functions of the R1 pprM gene of Heterococcus radiodurans, can solve problems that have not been reported before

Active Publication Date: 2011-11-09
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although it is generally believed that radiation resistance and drought stress resistance are evolutionarily synergistic, there is no report on the effect of Deinococcus radiodurans R1 pprM gene on improving plant drought resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of pprM gene of Deinococcus radiodurans R1 in improvement of drought-resistant traits of plants
  • Application of pprM gene of Deinococcus radiodurans R1 in improvement of drought-resistant traits of plants
  • Application of pprM gene of Deinococcus radiodurans R1 in improvement of drought-resistant traits of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Expression of D.radiodurans R1 pprM gene sequence in Escherichia coli

[0042] A pair of PCR-specific primers were designed according to the published pprM gene sequence in the D. radiodurans R1 genome to amplify the complete nucleotide sequence from the D. radiodurans R1 genome DNA.

[0043] Up 5' AGCGACTAGT GCCAAAT ATGTGCCGAGTTTC 3'; Down 5' ATCCCATATGTTACCAGCGGTCGTCGCGGC 3'. The sequence SEQ ID NO: 1 was amplified from the genome of D.radiodurans R1 by PCR method, conditions: 95°C 10min, [95°C 30sec, 55°C 30sec, 72°C 45sec] 30 cycles, 72°C 10min, PCR product After gel recovery, it was cloned on the vector pGEMT-easy, named pGEMT-pprM, and then the groEL promoter from D. radiodurans R1 was also connected to this vector to construct the E. coli expression vector pGEMT-pprMG, and express the The vector was transformed into Escherichia coli JM109, and the correctness of the inserted sequence was verified by PCR, enzyme digestion and sequencing (see figure 1 ,...

Embodiment 2

[0045] Example 2 The engineering strain containing D.radiodurans R1 pprM gene improves the tolerance experiment of drought and salt

[0046] 1. Experimental method

[0047] 1. The two recombinant Escherichia coli obtained in Example 1 were inoculated in 20mL LB liquid medium, and after shaking the flask for 3-4h, they were transferred to 100mL LB liquid medium to keep the inoculum as consistent as possible. , cultured to OD0.3-0.4, try to adjust to the same OD value.

[0048] 2. After centrifuging 10 mL of the bacterial solution, shock it in an equal volume of 4M NaCl salt solution and 3M sorbitol solution for 2 hours, and immediately dilute each sample to 10% with sterile deionized water. -4 , Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16h, observe and take pictures. Both 4M NaCl salt solution and 3M sorbitol are hypertonic solutions, which can simulate drought stress.

[0049] 2. Experimental results

[0050] From Figure 4 It can be seen t...

Embodiment 3

[0053] Example 3 Eukaryotic expression of D.radiodurans R1 pprM gene in rapeseed cells and identification of transgenic plants

[0054] (1) Construction of plant expression vector containing target gene

[0055] According to the genome sequence of D. radiodurans R1, the primers for pprM gene were designed for plant expression. Bam HI was added to the upstream primer, Sac I was added to the downstream primer, and the start codon was changed from gtg to atg. The primer sequence is as follows: DR0907 PLANT UP: CGGCGGATCC ATGTGCCGAGTTTCGATTGT;

[0056] DR0907 PLANT DOWN: ATTAGAGCTCTTACCAGCGGTCGTCGCGGC.

[0057] And the upstream has a Bam HI restriction site, and the downstream has a Sac I restriction site, the pprM (DR_0907) gene is amplified from the genome, and the fragment is recovered by Bam HI and Sac I double digestion gel and connected to the same On the plant expression vector pBI 121 of double digestion, the expression vector pBI 121-pprM containing the complete DR0907 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discovers that pprM gene in Deinococcus radiodurans R1 can enhance the drought resistance of prokaryotes and plants. Recombinant vectors comprising the gene are constructed and respectively introduced into procaryotic and enkaryotic host cells. Experiments prove that after the pprM gene is expressed in prokaryotic host cells and plants, the resistance to drought environment can be enhanced.

Description

technical field [0001] The present invention relates to the new function of Deinococcus radiodurans R1 pprM gene (Deinococcus radiodurans R1 pprM), and specifically relates to the use of the pprM gene in improving plant resistance to drought stress and the like. Background technique [0002] Deinococcus radiodurans R1 is a red bacterium discovered by Anderson et al in 1956 from cans that have been sterilized by radiation. [0003] The pprM gene (DR_0907, GeneID: 1797366) in Deinococcus radiodurans R1 is annotated as a cold shock protein. In 2009, Hirofumi Ohba et al. found that this gene can regulate a series of DNA damage repair-related proteins such as PprA dependent on PprI (Ohba, H. Satoh, et al., 2009) to participate in DNA damage repair after ionizing radiation, and this gene is also the key gene for radiation resistance of Deinococcus radiodurans R1. [0004] Although it is generally believed that radiation resistance and drought stress resistance are evolutionarily ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/63C12N15/82C12N1/15C12N1/19C12N1/21C12N5/10A01H5/00
Inventor 陈明王玮张维杨明坤李新娜林敏
Owner LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com