Application of pprM gene of Deinococcus radiodurans R1 in improvement of drought-resistant traits of plants
A gene and plant technology, applied in the field of new functions of the R1 pprM gene of Heterococcus radiodurans, can solve problems that have not been reported before
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Expression of D.radiodurans R1 pprM gene sequence in Escherichia coli
[0042] A pair of PCR-specific primers were designed according to the published pprM gene sequence in the D. radiodurans R1 genome to amplify the complete nucleotide sequence from the D. radiodurans R1 genome DNA.
[0043] Up 5' AGCGACTAGT GCCAAAT ATGTGCCGAGTTTC 3'; Down 5' ATCCCATATGTTACCAGCGGTCGTCGCGGC 3'. The sequence SEQ ID NO: 1 was amplified from the genome of D.radiodurans R1 by PCR method, conditions: 95°C 10min, [95°C 30sec, 55°C 30sec, 72°C 45sec] 30 cycles, 72°C 10min, PCR product After gel recovery, it was cloned on the vector pGEMT-easy, named pGEMT-pprM, and then the groEL promoter from D. radiodurans R1 was also connected to this vector to construct the E. coli expression vector pGEMT-pprMG, and express the The vector was transformed into Escherichia coli JM109, and the correctness of the inserted sequence was verified by PCR, enzyme digestion and sequencing (see figure 1 ,...
Embodiment 2
[0045] Example 2 The engineering strain containing D.radiodurans R1 pprM gene improves the tolerance experiment of drought and salt
[0046] 1. Experimental method
[0047] 1. The two recombinant Escherichia coli obtained in Example 1 were inoculated in 20mL LB liquid medium, and after shaking the flask for 3-4h, they were transferred to 100mL LB liquid medium to keep the inoculum as consistent as possible. , cultured to OD0.3-0.4, try to adjust to the same OD value.
[0048] 2. After centrifuging 10 mL of the bacterial solution, shock it in an equal volume of 4M NaCl salt solution and 3M sorbitol solution for 2 hours, and immediately dilute each sample to 10% with sterile deionized water. -4 , Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16h, observe and take pictures. Both 4M NaCl salt solution and 3M sorbitol are hypertonic solutions, which can simulate drought stress.
[0049] 2. Experimental results
[0050] From Figure 4 It can be seen t...
Embodiment 3
[0053] Example 3 Eukaryotic expression of D.radiodurans R1 pprM gene in rapeseed cells and identification of transgenic plants
[0054] (1) Construction of plant expression vector containing target gene
[0055] According to the genome sequence of D. radiodurans R1, the primers for pprM gene were designed for plant expression. Bam HI was added to the upstream primer, Sac I was added to the downstream primer, and the start codon was changed from gtg to atg. The primer sequence is as follows: DR0907 PLANT UP: CGGCGGATCC ATGTGCCGAGTTTCGATTGT;
[0056] DR0907 PLANT DOWN: ATTAGAGCTCTTACCAGCGGTCGTCGCGGC.
[0057] And the upstream has a Bam HI restriction site, and the downstream has a Sac I restriction site, the pprM (DR_0907) gene is amplified from the genome, and the fragment is recovered by Bam HI and Sac I double digestion gel and connected to the same On the plant expression vector pBI 121 of double digestion, the expression vector pBI 121-pprM containing the complete DR0907 ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap