Chicken Infectious Bronchitis Virus Rapid Detection Kit Based on Loop-Mediated Isothermal Amplification Technology and Its Application Method
A detection kit, ring-mediated isothermal technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, fluorescence/phosphorescence, etc., can solve the problems of difficult on-site application, long cycle, low sensitivity, etc., and achieve on-site application Convenience, high accuracy, high sensitivity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0036] 1. Make the loop-mediated isothermal amplification detection kit of avian infectious bronchitis virus according to the following formula:
[0037] (1) Prepare the following solutions separately: 1M Tris-HCl (pH 8.8), 1M KCl, 1M (NH4)2SO4, 100mM dNTP, 1M MgSO4, 1M MnCl2 solution, mix according to a certain ratio, add solid beet Alkali, calcein, make the final concentration of betaine 4M-5M, the final concentration of calcein is 0.01mM-1mM, use ddH 2 O constant volume configuration into 5 × reaction solution.
[0038] (2) Mix 8 U / μL of Bst DNA polymerase, 5 U / μL of AMV reverse transcriptase, and 40 U / μL of RNase inhibitor in a ratio of 2:1:1 to prepare an enzyme solution.
[0039] (3) Synthesize oligonucleotide deoxynucleic acid primers by DNA synthesizer according to the following sequence: There are three pairs of primers:
[0040] Inner primer 1:
[0041] GCTAGATGAACCAGAGGTCCTTCTTTTCCGTTGCTTGGGCTAC
[0042] Inner primer 2:
[0043] GTCACCTCCCCCCACATACCTTTTCGACCTTGTGCGAGAACGTAG
[...
Embodiment 2
[0065] 1. Make the loop-mediated isothermal amplification detection kit of avian infectious bronchitis virus according to the following formula:
[0066] (1) Prepare the following solutions separately: 1M Tris-HCl (pH 8.8), 1M KCl, 1M (NH4)2SO4, 100mM dNTP, 1M MgSO4, 1M MnCl2 solution, mix according to a certain ratio, add solid beet Alkali, calcein, make the final concentration of betaine 4M-5M, the final concentration of calcein is 0.01mM-1mM, and use ddH2O to make a 5× reaction solution.
[0067] (2) Mix 8 U / μL of Bst DNA polymerase, 5 U / μL of AMV reverse transcriptase, and 40 U / μL of RNase inhibitor in a ratio of 2:1:1 to prepare an enzyme solution.
[0068] (3) Synthesize oligonucleotide deoxynucleic acid primers by DNA synthesizer according to the following sequence: There are two pairs of primers:
[0069] Inner primer 1:
[0070] GCTAGATGAACCAGAGGTCCTTCTTTTCCGTTGCTTGGGCTAC
[0071] Inner primer 2:
[0072] GTCACCTCCCCCCACATACCTTTTCGACCTTGTGCGAGAACGTAG
[0073] Outer primer 1: GTTG...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap