Check patentability & draft patents in minutes with Patsnap Eureka AI!

Chicken Infectious Bronchitis Virus Rapid Detection Kit Based on Loop-Mediated Isothermal Amplification Technology and Its Application Method

A detection kit, ring-mediated isothermal technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, fluorescence/phosphorescence, etc., can solve the problems of difficult on-site application, long cycle, low sensitivity, etc., and achieve on-site application Convenience, high accuracy, high sensitivity effect

Inactive Publication Date: 2011-12-21
JIANGSU INST OF POULTRY SCI +2
View PDF3 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] An object of the present invention is to solve the problems of long period, low sensitivity, and difficulty in field application in the prior art for detection of chicken infectious bronchitis virus, and provide a loop-mediated isothermal amplification technique based on loop-mediated isothermal amplification of DNA, referred to as LAMP) rapid detection kit for chicken infectious bronchitis virus, suitable for detecting different serotypes of IB virus, and can be widely used in the field of veterinary testing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Make the loop-mediated isothermal amplification detection kit of avian infectious bronchitis virus according to the following formula:

[0037] (1) Prepare the following solutions separately: 1M Tris-HCl (pH 8.8), 1M KCl, 1M (NH4)2SO4, 100mM dNTP, 1M MgSO4, 1M MnCl2 solution, mix according to a certain ratio, add solid beet Alkali, calcein, make the final concentration of betaine 4M-5M, the final concentration of calcein is 0.01mM-1mM, use ddH 2 O constant volume configuration into 5 × reaction solution.

[0038] (2) Mix 8 U / μL of Bst DNA polymerase, 5 U / μL of AMV reverse transcriptase, and 40 U / μL of RNase inhibitor in a ratio of 2:1:1 to prepare an enzyme solution.

[0039] (3) Synthesize oligonucleotide deoxynucleic acid primers by DNA synthesizer according to the following sequence: There are three pairs of primers:

[0040] Inner primer 1:

[0041] GCTAGATGAACCAGAGGTCCTTCTTTTCCGTTGCTTGGGCTAC

[0042] Inner primer 2:

[0043] GTCACCTCCCCCCACATACCTTTTCGACCTTGTGCGAGAACGTAG

[...

Embodiment 2

[0065] 1. Make the loop-mediated isothermal amplification detection kit of avian infectious bronchitis virus according to the following formula:

[0066] (1) Prepare the following solutions separately: 1M Tris-HCl (pH 8.8), 1M KCl, 1M (NH4)2SO4, 100mM dNTP, 1M MgSO4, 1M MnCl2 solution, mix according to a certain ratio, add solid beet Alkali, calcein, make the final concentration of betaine 4M-5M, the final concentration of calcein is 0.01mM-1mM, and use ddH2O to make a 5× reaction solution.

[0067] (2) Mix 8 U / μL of Bst DNA polymerase, 5 U / μL of AMV reverse transcriptase, and 40 U / μL of RNase inhibitor in a ratio of 2:1:1 to prepare an enzyme solution.

[0068] (3) Synthesize oligonucleotide deoxynucleic acid primers by DNA synthesizer according to the following sequence: There are two pairs of primers:

[0069] Inner primer 1:

[0070] GCTAGATGAACCAGAGGTCCTTCTTTTCCGTTGCTTGGGCTAC

[0071] Inner primer 2:

[0072] GTCACCTCCCCCCACATACCTTTTCGACCTTGTGCGAGAACGTAG

[0073] Outer primer 1: GTTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an avian infectious bronchitis virus quick detection kit based on loop-mediated isothermal amplification technology and an application method thereof. The kit is composed of a (1) reaction solution, an (2) enzyme solution, a (3) primer solution and a (4) positive control solution, wherein the primer solution comprises three pairs of specific primers, i.e. inner primers, outer primers and loop primers. Before the reaction, a calcein-manganese complex is previously added, manganese is bonded with pyrophosphate ions precipitated by dNTP (deoxyribonucleotide triphosphate)to release calcein, and the result can be visually inspected and identified, wherein greenish yellow indicates a positive result, and light yellow indicates a negative result. The invention solves the problems of long period, low sensitivity, difficulty in field application and the like in the detection of avian infectious bronchitis virus in the prior art.

Description

Technical field [0001] The invention relates to the field of biological detection, in particular to a rapid detection kit for detecting avian infectious bronchitis virus based on loop-mediated isothermal amplification technology, Background technique [0002] Avian Infectious Bronchitis (Avian Infectious Bronchitis, IB) is an acute and highly contagious infectious disease in chickens caused by Avian Infectious Bronchitis Virus (IBV) of the genus Coronavirus of the Coronavirus family. Respiratory symptoms, decreased egg production and quality, and kidney disease in sick chickens. The disease is widespread worldwide and is one of the major infectious diseases that seriously endanger the world's poultry industry. [0003] At present, the detection methods of avian infectious bronchitis virus include traditional hemagglutination and hemagglutination inhibition, ELISA, neutralization test and RT-PCR methods. Traditional detection methods are time-consuming and cumbersome to operate. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64
Inventor 周生唐梦君戴亚斌刘梅章双杰程旭韦玉勇
Owner JIANGSU INST OF POULTRY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More