Method for efficiently preparing porcine circovirus 2 type empty capsid
A technology of porcine circovirus and empty capsid particles, applied in the direction of microorganism-based methods, botanical equipment and methods, biochemical equipment and methods, etc., can solve the problem of low expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0211] Expression of improved porcine circovirus antigen gene cap7 in silkworm bioreactor and assembly of empty capsid particles
[0212] Through the analysis of the experimental results of Example 1, it is found that if the highly expressed nuclear localization signal of cap5 is combined with the characteristic amino acid sequence of 47A and 59A highly expressed in cap2, it is possible to further improve the cap gene in the silkworm bioreactor expression efficiency.
[0213] We designed the following primers respectively: cap2-5F: 5'-GAAAAATGGCATCTTCAACGCCCGCCTCTC-3 (SEQ ID No.35) and cap2-5R: 5'-GAGAGGCGGGCGTTGAAGATGCCATTTTTC-3' (SEQ ID No.36), respectively using cap5F and cap2-5R as primers, The cap5 gene DNA was used as a template for PCR amplification; cap2-5F and cap2R were used for cap2 gene DNA as a template for PCR amplification. Finally, cap5F and cap2R were used as primers, and the corresponding PCR amplification products were purified and used as templates for fus...
Embodiment 3
[0216] Embodiment three, the animal experiment of porcine circovirus type 2 empty capsid particles expressed by silkworm
[0217] 1. Vaccine Preparation
[0218]Use the empty capsid particles of PCV2 virus purified in Example 2, check the pure empty capsid virions with an electron microscope, and after protein quantification, use oil or Aqueous adjuvant, the vaccine is prepared by mixing antigen and adjuvant in a ratio of 1:1, and is used for intramuscular injection to immunize one to two-week-old piglets negative for PCV2 antigen antibody.
[0219] 2. Immunization of Animals
[0220] Screen 70 PCV2 antigen antibody-negative healthy piglets aged 1-2 weeks, and randomly divide them into 7 groups with 10 piglets in each group. Groups 1-6 are divided into 0μg, 15μg, 30μg, 60μg, 90μg, and 120μg / head respectively according to the antigenic protein content. Dose, intramuscular injection of piglets, in which the commercialized PCV2 vaccine was used as a positive control in group 7....
Embodiment 1
[0617] Expected amplification result in Example 1: the first pair of primers PCVF-1F used for 1465bp
[0618] 16
[0619] GCTCCCGTATTTTTCTTGCGCTCGTC25
[0620] 17
[0621] 25
[0622] DNA
[0623] Artificial sequence
[0624]
[0625] Expected amplification result in Example 1: the first pair of primers PCVF-1R used for 1465bp
[0626] 17
[0627] CAAACGTTACAGGGTGCTGCTCTGC25
[0628] 18
[0629] 25
[0630] DNA
[0631] Artificial sequence
[0632]
[0633] Expected amplification result in Example 1: the first pair of primers PCVF-2F used for 1400bp
[0634] 18
[0635] CGTTACAGGGTGCTGCTCTGCAACG25
[0636] 19
[0637] 27
[0638] DNA
[0639] Artificial sequence
[0640]
[0641] Expected amplification result in Example 1: the first pair of primers PCVF-2R used for 1400bp
[0642] 19
[0643] GAGCTTCTACAGCTGGGACAGCAGTTG
[0644] 20
[0645] 35
[0646] DNA
[0647] Artificial sequence
[0648]
[0649] Primer PCV2-cap1F used in Example ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com