Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for identifying mycobacterium tuberculosis and nontuberculoaus mycobacteriosis quickly

A technology for Mycobacterium tuberculosis and Mycobacterium tuberculosis, which is applied in the field of detection and identification of pathogenic microorganisms, can solve the problems of expensive instruments and equipment, tedious operation processes, complicated methods, etc., and achieves high sensitivity, high reference value, and good specificity. Effect

Active Publication Date: 2013-06-05
广东省结核病控制中心 +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional biological identification methods are mainly based on bacterial growth rate, pigment production, drug resistance, biochemical reactions, etc. The method is complex and time-consuming, and it still takes 2 to 4 weeks to obtain the results after the isolated culture is obtained. Therefore, it is necessary to establish a A method for rapid diagnosis of Mycobacterium tuberculosis and non-tuberculosis Mycobacteria, which has important guiding significance for the confirmation of tuberculosis and clinical medication
[0003] Currently, the molecular biological methods for identifying Mycobacterium tuberculosis include PCR, ELISA, immunocolloidal gold and other methods, although the above methods may provide better clinical value , but due to the need for expensive instruments and equipment, cumbersome operation process, low sensitivity and other reasons, it has not been widely used clinically
Loop-Mediated Isothermal Amplification technology (Loop-Mediated Isothermal Amplification, hereinafter referred to as LAMP method) is a gene amplification technology developed by Eiken Chemical Co., Ltd. in Japan around 2000. It is fast, simple, accurate, easy to popularize, With the advantages of safety and reliability, the LAMP method has not yet been applied to the rapid identification of Mycobacterium tuberculosis and Mycobacterium nontuberculous

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying mycobacterium tuberculosis and nontuberculoaus mycobacteriosis quickly

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Preparation of the ring-mediated isothermal gene amplification reaction system:

[0037] (1) Reaction solution: 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO 4 , 5mM Betaine, the volume ratio of the four is 8:5:3:10;

[0038] (2) Primer solution: including 4 pmol / μl internal primer 1, 4 pmol / μl internal primer 2, 1 pmol / μl external primer 1, 1 pmol / μl external primer 2, the four primers are:

[0039] Internal primer 1: 5'- TGGTCGTAGTAGGTCGATGGGGGAGTCGATCTGCACACAGCT -3' (SEQ ID No.1);

[0040] Internal primer 2: 5'-TGCGCGATGGCGAACTCAAGGCACCGTAAACACCGTAG-3' (SEQ ID No.2);

[0041] Outer primer 1: 5'-TCATCGCCGATCATCAGG-3' (SEQ ID No.3);

[0042] Outer primer 2: 5'-CGAGTTTGGTCATCAGCCG-3' (SEQ ID No.4);

[0043] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0044] (4) Chromogen: Fluorescent dye 1×SYBR Green I.

[0045]Use the above reaction system to identify Mycobacterium tuberculosis and non-tuberculous mycobacteria in the following mann...

Embodiment 2

[0058] Embodiment 2 Conventional PCR reaction and the comparison of the method sensitivity of the present invention

[0059] The isolated and purified Mycobacterium tuberculosis was sequentially diluted to 1.0×10 6 , 1.0×10 5 , 1.0×10 4 , 1.0×10 3 , 1.0×10 2 , 1.0×10 1 CFU / mL, identified by the identification method of the present invention and conventional PCR method respectively.

[0060] 1. LAMP detection method of the present invention

[0061] Preparation of the ring-mediated isothermal gene amplification reaction system:

[0062] (1) Reaction solution: 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO 4 , 5mM Betaine, the volume ratio of the four is 8:5:3:10;

[0063] (2) Primer solution: including 8 pmol / μl internal primer 1, 8 pmol / μl internal primer 2, 1 pmol / μl external primer 1, 1 pmol / μl external primer 2, the four primers are:

[0064] Internal primer 1: 5'- TGGTCGTAGTAGGTCGATGGGGAGTCGATCTGCACACAGCT -3' (SEQ ID No.1); Internal primer 2: 5'- TGCGCGA...

Embodiment 3

[0089] Embodiment 3 specificity experiment

[0090] Using the identification method of Example 1 to isolate and purify Mycobacterium tuberculosis, Mycobacterium avium intracellulare, Mycobacterium kansasii, Mycobacterium fortuitously, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium toads, Mycobacterium suja, Mycobacterium marmum, Mycobacterium simianum, Mycobacterium haemophilus, Mycobacterium terreus, Mycobacterium scrofula, Mycobacterium phlei, Mycobacterium flavum, Mycobacterium fortuitum and Mycobacterium gordonii were identified. Check with the routine PCR method of Example 2.

[0091] The identification results showed: Mycobacterium avium intracellulare, Mycobacterium kansasii, Mycobacterium fortuitously, Mycobacterium chelonis, Mycobacterium abscessus, Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium toads, Sugafen Mycobacterium, Mycobacterium marmum, Mycobacterium simianum, Mycobacterium haem...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying mycobacterium tuberculosis and nontuberculoaus mycobacteriosis quickly. In the principle of the method, four specific primers are designed according to the specificity of the mycobacterium tuberculosis and nontuberculoaus mycobacteriosis 16S ribonucleic acid (RNA), a deoxyribonucleic acid (DNA) template of a sample is amplified at the temperature of between 63 and 65 DEG C by using the four specific primers and DNA polymerase with strand displacement activity, the amplification efficiency can reach 109 to 1,010 copies within a short time, and color change is observed by adding SYBR Green I to judge whether the template is amplified or not. The method has the advantages of high sensitivity, high specificity and the like, is convenient and quick, has relatively high reference value on the diagnosis and clinical administration of the mycobacterium tuberculosis or the nontuberculoaus mycobacteriosis, and is suitable for popularization and application.

Description

technical field [0001] The invention relates to the detection and identification of pathogenic microorganisms, in particular to a method for rapidly identifying tuberculosis mycobacteria and non-tuberculous mycobacteria by using a loop-mediated isothermal gene amplification technique (LAMP technique). Background technique [0002] In recent years, the infection of non-tuberculous mycobacteria has increased significantly, and it is difficult to distinguish the diseases caused by tuberculosis and non-tuberculous mycobacteria clinically. Therefore, the correct identification of mycobacteria is very important in the diagnosis and treatment of the disease. Traditional biological identification methods are mainly based on bacterial growth rate, pigment production, drug resistance, biochemical reactions, etc. The method is complex and time-consuming, and it still takes 2 to 4 weeks to obtain the results after the isolated culture is obtained. Therefore, it is necessary to establish...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
Inventor 钟球石磊陈涛常彦磊周琳叶宇鑫唐大运
Owner 广东省结核病控制中心