Method for identifying mycobacterium tuberculosis and nontuberculoaus mycobacteriosis quickly
A technology for Mycobacterium tuberculosis and Mycobacterium tuberculosis, which is applied in the field of detection and identification of pathogenic microorganisms, can solve the problems of expensive instruments and equipment, tedious operation processes, complicated methods, etc., and achieves high sensitivity, high reference value, and good specificity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Preparation of the ring-mediated isothermal gene amplification reaction system:
[0037] (1) Reaction solution: 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO 4 , 5mM Betaine, the volume ratio of the four is 8:5:3:10;
[0038] (2) Primer solution: including 4 pmol / μl internal primer 1, 4 pmol / μl internal primer 2, 1 pmol / μl external primer 1, 1 pmol / μl external primer 2, the four primers are:
[0039] Internal primer 1: 5'- TGGTCGTAGTAGGTCGATGGGGGAGTCGATCTGCACACAGCT -3' (SEQ ID No.1);
[0040] Internal primer 2: 5'-TGCGCGATGGCGAACTCAAGGCACCGTAAACACCGTAG-3' (SEQ ID No.2);
[0041] Outer primer 1: 5'-TCATCGCCGATCATCAGG-3' (SEQ ID No.3);
[0042] Outer primer 2: 5'-CGAGTTTGGTCATCAGCCG-3' (SEQ ID No.4);
[0043] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;
[0044] (4) Chromogen: Fluorescent dye 1×SYBR Green I.
[0045]Use the above reaction system to identify Mycobacterium tuberculosis and non-tuberculous mycobacteria in the following mann...
Embodiment 2
[0058] Embodiment 2 Conventional PCR reaction and the comparison of the method sensitivity of the present invention
[0059] The isolated and purified Mycobacterium tuberculosis was sequentially diluted to 1.0×10 6 , 1.0×10 5 , 1.0×10 4 , 1.0×10 3 , 1.0×10 2 , 1.0×10 1 CFU / mL, identified by the identification method of the present invention and conventional PCR method respectively.
[0060] 1. LAMP detection method of the present invention
[0061] Preparation of the ring-mediated isothermal gene amplification reaction system:
[0062] (1) Reaction solution: 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO 4 , 5mM Betaine, the volume ratio of the four is 8:5:3:10;
[0063] (2) Primer solution: including 8 pmol / μl internal primer 1, 8 pmol / μl internal primer 2, 1 pmol / μl external primer 1, 1 pmol / μl external primer 2, the four primers are:
[0064] Internal primer 1: 5'- TGGTCGTAGTAGGTCGATGGGGAGTCGATCTGCACACAGCT -3' (SEQ ID No.1); Internal primer 2: 5'- TGCGCGA...
Embodiment 3
[0089] Embodiment 3 specificity experiment
[0090] Using the identification method of Example 1 to isolate and purify Mycobacterium tuberculosis, Mycobacterium avium intracellulare, Mycobacterium kansasii, Mycobacterium fortuitously, Mycobacterium chelonae, Mycobacterium abscessus, Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium toads, Mycobacterium suja, Mycobacterium marmum, Mycobacterium simianum, Mycobacterium haemophilus, Mycobacterium terreus, Mycobacterium scrofula, Mycobacterium phlei, Mycobacterium flavum, Mycobacterium fortuitum and Mycobacterium gordonii were identified. Check with the routine PCR method of Example 2.
[0091] The identification results showed: Mycobacterium avium intracellulare, Mycobacterium kansasii, Mycobacterium fortuitously, Mycobacterium chelonis, Mycobacterium abscessus, Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium toads, Sugafen Mycobacterium, Mycobacterium marmum, Mycobacterium simianum, Mycobacterium haem...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 