Fully human TNFalpha-Fab antibody and its PEG antibody

An antibody and whole-human technology, applied in the direction of antibodies, anti-inflammatory agents, chemical instruments and methods, etc., can solve the problems of accelerated metabolism, increased antigenicity of Fab fragments, shortened half-life, etc., to achieve good affinity, avoid short half-life, and prolong the effect of time

Active Publication Date: 2014-01-01
优锐生物医药科技(深圳)有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, due to the removal of the Fc fragment, the Fab fragment has these defects, including: 1. Due to the expression in E. coli, the antigenicity of the Fab fragment is increased; 2. Due to the removal of the Fc fragment, the metabolism in the body is accelerated and the half-life is shortened

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fully human TNFalpha-Fab antibody and its PEG antibody
  • Fully human TNFalpha-Fab antibody and its PEG antibody
  • Fully human TNFalpha-Fab antibody and its PEG antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Obtaining of B cells secreting anti-human TNFa antibody

[0031] Take 5 milliliters of peripheral blood from patients with active rheumatoid arthritis, separate leukocytes with lymphocyte separation medium, culture them, and identify positive clones according to the results of ELISA.

[0032] 1. Select blood sample

[0033]In order to obtain human B cells that secrete anti-human TNFα, human TNFα (purchased from Shenzhen Jingmei Company) was used to routinely coat a 96-well plate, and each well was coated with 250 ng of the protein overnight. Then, it was blocked with 5% skimmed milk powder at room temperature for 2 hours, and the milk powder was prepared with pH7.2 PBS. After washing, 100 microliters of sera from different patients were added and incubated at room temperature for 1 hour. Then add peroxidase-labeled goat anti-human IgG and let stand at room temperature for 1 hour. After washing at least 5 times, add TMD or other chromogenic reagents and trea...

Embodiment 2

[0038] Example 2 Obtaining of the Variable Region of the Whole Human TNFa-Fab Antibody Gene

[0039] Take 5,000-10,000 positive clone cells, use Trizol (GIBCO) to separate total RNA, and use Superscript III First-strand reverse transcriptase (invitrogen company product) to obtain cDNA. The above operations were carried out in accordance with the manufacturer's instructions. PCR was carried out with the following primers and conditions, and the amplification enzyme used was KOD-plus of TOYOBO to ensure that possible mutations were reduced during the amplification process.

[0040] Light chain upstream primer: GCTAGCGCCGCCACCATGGACATGCGGG (SEQ ID NO: 1)

[0041] Light chain downstream primer: TTTGATCTCAAGCTTGGTCC (SEQ ID NO: 2)

[0042] Heavy chain upstream primer: CCGGAATTCGCCGCCACCATGGAGTT (SEQ ID NO: 3)

[0043] Heavy chain downstream primer: ACTCGAGACGGTGACCAGTGTA (SEQ ID NO: 4)

[0044] PCR conditions:

[0045] a) The composition of the reaction system:

[0046]

...

Embodiment 3

[0060] Example 3 Preparation of fully human TNFa-Fab antibody

[0061] 1. Acquisition of human IgG1 light chain constant region and heavy chain Fd fragment coding sequence

[0062] We synthesized the light chain constant region of human IgG1 and the heavy chain CH1 gene sequence in order to constitute the complete human TNFa-Fab antibody gene. According to the literature, the DNA coding sequence of the human IgG1 light chain constant region is as follows: (5'→3') (SEQ ID NO: 9)

[0063] CGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAG

[0064] The human IgG1 heavy chain CH1 gene coding sequence is as follows:

[0065] (5'→3') (SEQ ID NO: 10)

[0066] GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a fully human TNFa-Fab antibody and the PEGylated antibody thereof. The amino acid sequence of the light chain variable region of the present fully human TNFa-Fab antibody is SEQ ID NO: 7, and that of the heavy chain variable region is SEQ ID NO: 8. The present invention further discloses the coding gene for said fully human TNFa-Fab antibody, and host cells in which the coding gene is expressed. The present fully human TNFa-Fab antibody can be used to treat inflammations related to TNFa, such as rheumatoid arthritis.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to Fab fragments of TNFα antibodies and PEGylated antibodies thereof. Background technique [0002] The incidence of autoimmune diseases is high. About 355 million people in the world suffer from various autoimmune diseases. In 1999, the World Health Organization listed rheumatism, cancer and cardiovascular disease as the three major killers threatening human health. Rheumatism has a high incidence rate and a high disability rate. In my country, there are more than ten million disabled people caused by rheumatism. Among them, rheumatoid arthritis (RA) and ankylosing spondylitis (AS) are the most harmful, and the disability rates of untreated RA and AS are as high as 70% and 30%, respectively. [0003] At present, the commonly used methods to fight autoimmune diseases are not to use steroids (steroids) to slow down the inflammatory response (inflammation) caused by the immune system att...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/13A61K47/48A61P19/04A61P29/00C12N1/21A61P19/02C12N5/10C07K16/24A61K39/395
CPCC07K16/241C07K2317/92C07K2317/21A61K2039/505C07K2317/55A61P19/02A61P19/04A61P29/00A61P37/02
Inventor倪健朱向玲
Owner优锐生物医药科技(深圳)有限公司